ID: 1073551234

View in Genome Browser
Species Human (GRCh38)
Location 10:104403618-104403640
Sequence TTATATAAAAAGTTGGAGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 10, 3: 36, 4: 457}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073551234_1073551236 14 Left 1073551234 10:104403618-104403640 CCTAACTCCAACTTTTTATATAA 0: 1
1: 0
2: 10
3: 36
4: 457
Right 1073551236 10:104403655-104403677 GCAACTAATTAAAGATAGATAGG 0: 1
1: 0
2: 0
3: 19
4: 179
1073551234_1073551239 30 Left 1073551234 10:104403618-104403640 CCTAACTCCAACTTTTTATATAA 0: 1
1: 0
2: 10
3: 36
4: 457
Right 1073551239 10:104403671-104403693 AGATAGGATATTCAAACGGGTGG 0: 1
1: 0
2: 0
3: 4
4: 60
1073551234_1073551237 26 Left 1073551234 10:104403618-104403640 CCTAACTCCAACTTTTTATATAA 0: 1
1: 0
2: 10
3: 36
4: 457
Right 1073551237 10:104403667-104403689 AGATAGATAGGATATTCAAACGG 0: 1
1: 0
2: 1
3: 44
4: 439
1073551234_1073551238 27 Left 1073551234 10:104403618-104403640 CCTAACTCCAACTTTTTATATAA 0: 1
1: 0
2: 10
3: 36
4: 457
Right 1073551238 10:104403668-104403690 GATAGATAGGATATTCAAACGGG 0: 1
1: 0
2: 3
3: 32
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073551234 Original CRISPR TTATATAAAAAGTTGGAGTT AGG (reversed) Intronic
901611199 1:10499747-10499769 TTACAGAAAAAATTGTAGTTTGG - Intronic
903924484 1:26821931-26821953 TTATATAAAAAGTAAGGGCTGGG - Intergenic
904164753 1:28546916-28546938 TTTTTTAAAAAGTTGGGGTACGG + Intergenic
908641849 1:66232601-66232623 TTGGAAAAAAAGTTAGAGTTTGG + Intronic
908845245 1:68317926-68317948 TTAGAAAATAAATTGGAGTTAGG - Intergenic
909893764 1:81039431-81039453 TTTTATTAAAACTTGGATTTTGG + Intergenic
910095365 1:83515615-83515637 GTATTTAAAAAAGTGGAGTTTGG - Intergenic
910928571 1:92420696-92420718 GTGTAGAACAAGTTGGAGTTGGG + Intergenic
911023717 1:93414377-93414399 TTGTTTATAAAGTTTGAGTTAGG + Intergenic
911587896 1:99712037-99712059 TTATATTACAAGTTGTAATTTGG - Intronic
913377411 1:118168288-118168310 TTAAGGGAAAAGTTGGAGTTTGG + Intronic
914045508 1:144088354-144088376 TTATATAAAAATTTGGAGATGGG - Intergenic
914132602 1:144872331-144872353 TTATATAAAAATTTGGAGATGGG + Intergenic
915159474 1:153907522-153907544 ATATATACAAAGTTTCAGTTTGG + Intronic
915681385 1:157584998-157585020 TTGTATCAAAAGCTGGAGGTAGG + Intronic
917553521 1:176059443-176059465 TTTTTTAAAAATTTGTAGTTAGG + Intronic
918214751 1:182383938-182383960 TTCTATTAAAAGTGGGAATTAGG - Exonic
918873145 1:190003098-190003120 TGATTTAAAAATCTGGAGTTTGG - Intergenic
918879952 1:190105017-190105039 TTAAATATAAATTTGGAATTAGG + Intronic
919245415 1:194976947-194976969 TTGTATAAAATGTTACAGTTTGG - Intergenic
919298174 1:195727918-195727940 TTATATAAAAAGATGTTGGTGGG + Intergenic
919505509 1:198393280-198393302 TAATTTAAAAAGATGCAGTTGGG - Intergenic
919514102 1:198500310-198500332 TTATAGAAAAATTGTGAGTTAGG + Intergenic
919556442 1:199060529-199060551 TTATAGTAAGTGTTGGAGTTGGG - Intergenic
919596798 1:199574419-199574441 GTATATAAAAAGTGTGAGCTGGG + Intergenic
920761782 1:208790667-208790689 TTATATAAAATGTTAATGTTAGG + Intergenic
921171076 1:212550219-212550241 TGAAATAAAAATTTGGAGATAGG - Intergenic
921585999 1:216947029-216947051 TTATAAAAGAAGTTGGATGTTGG - Intronic
923349981 1:233094877-233094899 TGATTTAAAAAGTATGAGTTGGG + Intronic
924590965 1:245403934-245403956 TTGTATCAAAAATTGTAGTTTGG + Intronic
924906187 1:248455013-248455035 TTTTGTAATTAGTTGGAGTTAGG + Intergenic
924921702 1:248637024-248637046 TTTTGTAATTAGTTGGAGTTAGG - Intergenic
1063323310 10:5072774-5072796 TTATAAAAAATGGTGGTGTTAGG + Intronic
1063443919 10:6096185-6096207 TTTTTTAAAAAGTGGCAGTTGGG + Intronic
1064589974 10:16879468-16879490 TTATATAAAATAATGTAGTTTGG - Intronic
1064598613 10:16971261-16971283 TTATGTAAGATGTTGGACTTTGG + Intronic
1064657187 10:17567979-17568001 TTAAAAATTAAGTTGGAGTTAGG + Intergenic
1065222854 10:23513865-23513887 ATTTATAAGAAGTTTGAGTTGGG + Intergenic
1066119113 10:32266795-32266817 ATATATAAAAGTATGGAGTTTGG - Intergenic
1067679694 10:48423753-48423775 TTATTTACAAAGTTTGTGTTTGG + Intronic
1068047580 10:51907250-51907272 TGAAAAAAAAACTTGGAGTTTGG - Intronic
1070234918 10:74613805-74613827 TTATATTAATATTTTGAGTTGGG - Intronic
1070259162 10:74837417-74837439 TTCTATAAAAACTTGAAGGTTGG - Intronic
1070360557 10:75684509-75684531 AAATATAAAAAGTAGCAGTTTGG + Intronic
1070616928 10:77976429-77976451 TTCTATTAAAATTTGTAGTTTGG - Exonic
1071768226 10:88693488-88693510 TCATATATAAAGTTGAAGATGGG - Intergenic
1072476864 10:95770010-95770032 GGATATACAAATTTGGAGTTTGG + Intronic
1073248454 10:102107594-102107616 TTTTAAAAAAACTTGGAGCTGGG + Exonic
1073551234 10:104403618-104403640 TTATATAAAAAGTTGGAGTTAGG - Intronic
1073603767 10:104872523-104872545 TTATTCAGAAAGTTGGAGATGGG + Intronic
1073959118 10:108905643-108905665 TTATATTTAAACTTGGATTTTGG - Intergenic
1074073663 10:110099972-110099994 TGGTATTAAAAGTAGGAGTTGGG + Intronic
1074694840 10:116040894-116040916 TTATGTAAAAAGATTCAGTTCGG + Intergenic
1075268514 10:121027191-121027213 TTAAATAAAATTTTGAAGTTTGG + Intergenic
1075607929 10:123828689-123828711 TTATATAAAAGGTGAGATTTAGG - Intronic
1076095137 10:127727613-127727635 TTAAATAAAAAATTTGAGGTGGG + Intergenic
1077071053 11:673229-673251 TTCTATAAAAAGTAGAAGCTGGG + Intronic
1078303665 11:10160302-10160324 TTATAGAAAAAGGTATAGTTTGG - Intronic
1078936680 11:15957456-15957478 TTATTTAAAAAGTGGGTGCTGGG + Intergenic
1079501182 11:21102939-21102961 ATATATAAGAATTTGGAATTGGG + Intronic
1079961733 11:26932720-26932742 TTAAAGAAAAAATGGGAGTTTGG - Intergenic
1080605683 11:33863022-33863044 TTATATAAAACGGTAGAGATAGG + Intronic
1081497063 11:43622472-43622494 TTAAAAAAACAGTTGGACTTTGG + Intronic
1081554875 11:44149358-44149380 TCTTAAAAACAGTTGGAGTTTGG + Intronic
1081777657 11:45686840-45686862 TTTTTTAAAAAATTGGACTTTGG + Intergenic
1082020434 11:47528448-47528470 TTTTTTAAAAAGTTAAAGTTTGG + Intronic
1082619241 11:55400123-55400145 TAATATCAAAGGTTGGAGGTAGG - Intergenic
1084347535 11:68565207-68565229 TTATTTAACTATTTGGAGTTGGG + Intronic
1085606352 11:77903068-77903090 TTCTATAAAATGTGGCAGTTGGG - Intronic
1085857493 11:80191983-80192005 TTACATAAAAAGTTAGAATCAGG - Intergenic
1086148351 11:83580674-83580696 TTATGTTGAAAGTTGGAGATAGG - Intronic
1086253693 11:84848541-84848563 CCATGTAAAAAGCTGGAGTTGGG - Intronic
1086442773 11:86845841-86845863 TTTTATAAGAAATTGGAATTGGG - Intronic
1086621949 11:88897251-88897273 TTATATCAAAATTTTAAGTTTGG - Intronic
1086770506 11:90758771-90758793 TTATATAATAAGTTTGAAATAGG - Intergenic
1086789922 11:91024059-91024081 TTATAAAAAGACTTGGAATTTGG - Intergenic
1086880997 11:92153072-92153094 TTATATGAAATTTTGGAGCTGGG - Intergenic
1088313097 11:108480785-108480807 ATATATGTAAAGTGGGAGTTGGG - Intronic
1088952558 11:114586398-114586420 TGAAATAAAAAGAAGGAGTTGGG - Intronic
1089188778 11:116639076-116639098 TTGTTGAAAAATTTGGAGTTCGG - Intergenic
1090508122 11:127341532-127341554 TTGTGAGAAAAGTTGGAGTTAGG + Intergenic
1090923041 11:131224034-131224056 TCATATGAAGGGTTGGAGTTTGG - Intergenic
1091478087 12:797430-797452 TTTTATAAAAAGGTAGATTTTGG + Intronic
1092072349 12:5641759-5641781 TTATATCAAGATTTGGAGTTGGG + Intronic
1092682970 12:11008301-11008323 TAATATAAAAATTTTGAATTAGG - Intronic
1093547279 12:20363657-20363679 ATATATAAAAAGTAGCAGTTTGG + Intergenic
1093905210 12:24683212-24683234 TAATAAAAAAATTTGAAGTTTGG - Intergenic
1094246257 12:28298138-28298160 TTATATTAAAAATTGGATTTGGG + Intronic
1094770951 12:33659303-33659325 TTTTTAAAAAAGTTGGTGTTAGG + Intergenic
1095114959 12:38342460-38342482 TTTTATAAAGAGTTGGTGGTTGG + Intergenic
1096447319 12:51705121-51705143 TCATAAAAAAAGTTTGATTTTGG - Intronic
1096937160 12:55293904-55293926 ATATAAAAAAAGTTGGATTAAGG - Intergenic
1097783504 12:63734156-63734178 TTATAGAAATAGATGGACTTGGG - Intergenic
1097836574 12:64279213-64279235 TTTTACAAAATGGTGGAGTTGGG - Intronic
1098754624 12:74344713-74344735 TTATATCCAAAGTTGTACTTTGG - Intergenic
1098754696 12:74346089-74346111 TTATATCCAAAGTTGTACTTTGG + Intergenic
1099266907 12:80459107-80459129 TAAAATAAAAAACTGGAGTTGGG - Intronic
1099316565 12:81090535-81090557 TTATATAAAAAATCAGATTTAGG - Intronic
1099392037 12:82093531-82093553 TTATATAATAATTTGAAGTTGGG + Intergenic
1099449176 12:82788277-82788299 TTATATAAATATTTAGAGTAAGG + Intronic
1099807547 12:87539099-87539121 TTATATATAAAGGTGGTCTTGGG + Intergenic
1100566845 12:95803817-95803839 TTATATGGAAACATGGAGTTAGG - Intronic
1101540618 12:105661682-105661704 TTACATTAAAAGTTAGAGTTTGG + Intergenic
1104823950 12:131695142-131695164 TTAAGAAAAAAGTTGGAGTCCGG - Intergenic
1106872209 13:34033932-34033954 GTACATAAAAAGTTAGAGTTTGG + Intergenic
1107439411 13:40411404-40411426 TTATATAAAGTGTTAGATTTTGG - Intergenic
1107660459 13:42633905-42633927 TAATAAAGAAAGTTGGAGTGAGG - Intergenic
1107686364 13:42903817-42903839 TTATTTATAAACTTGGAGTGAGG + Intronic
1108052190 13:46456962-46456984 TCATATAAAAATTTGGATTATGG + Intergenic
1108666895 13:52641845-52641867 TTATTTAATAATTTTGAGTTGGG - Exonic
1108864157 13:54902357-54902379 TTATGTAAAAAGTTTTATTTGGG - Intergenic
1109270688 13:60252048-60252070 TTATTAAAAAAGTAGGAGTGAGG - Intergenic
1109759392 13:66807448-66807470 TTATATAAGAACTTGCAGCTGGG + Intronic
1109788256 13:67211482-67211504 TTAAATAAAAATTTGAAATTTGG + Intronic
1110045638 13:70826716-70826738 TTATATAAAGATTTTAAGTTTGG - Intergenic
1110071153 13:71179585-71179607 TTAAATAAAAAGTTGAAAATAGG + Intergenic
1110444413 13:75562311-75562333 TAATAGAGAAATTTGGAGTTAGG + Intronic
1111060507 13:83012486-83012508 TAATAAAGAAAGTTGGTGTTAGG + Intergenic
1111099379 13:83562645-83562667 TTATATAAAAAATTTGAGGCAGG + Intergenic
1111726129 13:92011728-92011750 TTATATATAAAGTGCTAGTTTGG + Intronic
1111758439 13:92429674-92429696 TTATATAAAAATCTAGAATTTGG + Intronic
1113097211 13:106678634-106678656 ATATACAAAATGTTGGGGTTGGG - Intergenic
1113223666 13:108134767-108134789 TTATATAAAAAGGAGAAATTTGG + Intergenic
1114507308 14:23227110-23227132 TTATATAAGAAGTTATCGTTGGG + Intronic
1114595239 14:23906381-23906403 TTTTAAAAAATGTGGGAGTTGGG - Intergenic
1116020591 14:39455475-39455497 ATATAGAAAAAGATGGTGTTGGG - Intergenic
1116115859 14:40649800-40649822 TTATATATAAAATTGAAGTTCGG + Intergenic
1116221107 14:42088463-42088485 CAATATAAAAAGTTAGAGTTAGG + Intergenic
1116590874 14:46770810-46770832 TCTTATAAAAAGTTGAAATTTGG + Intergenic
1116842112 14:49829620-49829642 CTATATAAGGAGTGGGAGTTAGG - Intronic
1116914947 14:50515659-50515681 CTATACAAGAAGTTGTAGTTTGG - Intronic
1117116946 14:52523924-52523946 TTGTATAAAAATTTGCAGTTTGG + Intronic
1117243891 14:53864103-53864125 TTATATAAAATGTTAGAGGACGG + Intergenic
1118736317 14:68704172-68704194 TTATAAAAAAATTAGGAGATGGG + Intronic
1119042626 14:71288779-71288801 TTAAAAAAAAAGTTAGAGATGGG - Intergenic
1119212324 14:72841504-72841526 TTCAGTAAAAAGTTGGGGTTAGG + Intronic
1119443666 14:74646662-74646684 TTACATAAAAAACTGGAGTTTGG + Intergenic
1119814719 14:77555569-77555591 TTAAATCAAAATTGGGAGTTTGG + Intronic
1119976989 14:79036213-79036235 TGTTATAAGAAGTTGGAGGTGGG - Intronic
1120511287 14:85418278-85418300 TTATATAAATAGATGCAGATAGG + Intergenic
1122948789 14:105029024-105029046 TTAAATAAAAGGTTGTATTTGGG - Intergenic
1125025600 15:35026256-35026278 TTATATAAGAAATTAGATTTTGG - Intergenic
1125487470 15:40122296-40122318 TTTTATAAATAGATGAAGTTGGG - Intergenic
1126224394 15:46253505-46253527 ATATGTAAAAATTTTGAGTTTGG + Intergenic
1127055260 15:55125075-55125097 TTAAATAAAGAGTTGGGGTGAGG + Intergenic
1127554573 15:60074988-60075010 TCATGTAAAAAGTAGGGGTTTGG + Intergenic
1127619466 15:60719624-60719646 TAATTTAAAGAGTTGGGGTTTGG + Intronic
1127721230 15:61701979-61702001 GTTTATGAAAAGTTGGAGTCAGG - Intergenic
1127737551 15:61858307-61858329 ATAGATAGATAGTTGGAGTTTGG - Intronic
1127817342 15:62622824-62622846 TAATAAAATAAGATGGAGTTTGG + Intronic
1127946396 15:63758889-63758911 TTAAAAAAAAAGTTGGGGGTGGG - Intronic
1128016524 15:64352743-64352765 TTTTATAAAGAGTTGAAATTAGG - Intronic
1129141080 15:73598495-73598517 TAGTTTAAAAACTTGGAGTTAGG + Intronic
1129477241 15:75794050-75794072 TGAAATAAAAAGTTGGTTTTTGG - Intergenic
1129786109 15:78311233-78311255 TTATTTACAAAGTTGGTGGTGGG + Intergenic
1130034641 15:80346712-80346734 TTATATAAAAAATTTGAGAGTGG + Intronic
1130235690 15:82131526-82131548 TTATTTAAAATGTTCAAGTTTGG + Intronic
1130308861 15:82735274-82735296 TTATATATAAGATTGGAGTAGGG + Intergenic
1130601249 15:85275522-85275544 TTATATTAAAACTTGGAGGCTGG + Intergenic
1130813661 15:87407975-87407997 TTATCTAAAAATTTGGGGTCAGG - Intergenic
1131107129 15:89742856-89742878 TTATAAAGACAGTTTGAGTTGGG - Intronic
1131180891 15:90239106-90239128 CTATATAAACAGTTGAAGATTGG + Intronic
1131924545 15:97367943-97367965 TTCCATAAAAAGTTGGTGGTGGG + Intergenic
1132388001 15:101415432-101415454 TTATGTAAAAATATGGATTTGGG - Intronic
1132389864 15:101430391-101430413 TTAGACAAAAAGGTGGAGTGGGG - Intronic
1134305296 16:13026563-13026585 ATATATAAAAAGTTGAAATCTGG - Intronic
1135114266 16:19712205-19712227 TTATTCAGAAACTTGGAGTTGGG - Intronic
1137039322 16:35595623-35595645 TTATATAAAACTTTGAAGGTAGG + Intergenic
1137414357 16:48259948-48259970 TTATTTAAAAAGTAGGAATTAGG + Intronic
1137797453 16:51233957-51233979 TGGTATAAAAAGTTGGGGATTGG - Intergenic
1139078207 16:63481353-63481375 TTATATAACAAGTAAGAGATGGG + Intergenic
1139155678 16:64438796-64438818 TTATATAAAATGTTTGGATTAGG + Intergenic
1140572161 16:76120175-76120197 TTATATAAAAAGTGAAAATTGGG + Intergenic
1140754295 16:78053694-78053716 TTATATAAATATTTGCAGATGGG + Intronic
1141053215 16:80792127-80792149 AAATATCAAAAGTTGAAGTTAGG - Intronic
1141226723 16:82123274-82123296 TGAAATAAAAAGTTGGTTTTTGG + Intergenic
1142368454 16:89663814-89663836 TTATATAAAACGTTCGCTTTGGG + Intronic
1143405376 17:6674111-6674133 TCATAAAGAAACTTGGAGTTTGG + Intergenic
1143847476 17:9783668-9783690 TTACGTAAAAAGTGGGAGCTGGG + Intronic
1144009437 17:11132605-11132627 TTATTTAACAAGGTGGTGTTGGG - Intergenic
1144194253 17:12875294-12875316 TTGTATAAAAAATTGGGGTCTGG + Intronic
1144858035 17:18281279-18281301 TTATTTAAATGATTGGAGTTCGG - Intronic
1146530210 17:33602110-33602132 TTAGATAAGACTTTGGAGTTTGG + Intronic
1146560921 17:33869666-33869688 TTATATAAAATATTGGGATTAGG + Intronic
1147203899 17:38823136-38823158 TTAAAAAAAAAGTTGGAGTCAGG - Intronic
1147997378 17:44368079-44368101 TTATATATATAGTGGGTGTTTGG - Intergenic
1150049415 17:61945877-61945899 TTAATTAAAAAGTTGCAGTAGGG - Exonic
1150776954 17:68088777-68088799 ATGTATAAAGAGTGGGAGTTAGG + Intergenic
1150983872 17:70173432-70173454 TTGTATGAAAAGTTGAAGATGGG + Intronic
1151102247 17:71569376-71569398 TTGTATACAAAATTGAAGTTTGG + Intergenic
1153555781 18:6311670-6311692 TTACATAAGAAGTTGGGGATGGG + Intronic
1154140485 18:11819960-11819982 TAAAAAAAAAAGTTAGAGTTGGG + Intronic
1154308680 18:13250436-13250458 TGAAACAAAAAGTTGGATTTTGG + Intronic
1156132337 18:33991308-33991330 TTATAAATAAAGTTTCAGTTGGG - Intronic
1157593938 18:48852460-48852482 TTCTAGAAAAAGTTGGAGGTGGG - Intronic
1157708470 18:49829878-49829900 TCATTAAAAAAGTTGGATTTTGG - Intronic
1157843383 18:50980040-50980062 TTAAATAAACAGTTGGAGTTGGG + Intronic
1158216173 18:55102899-55102921 TTATTTAAAAAATTGGTTTTTGG - Intergenic
1158348662 18:56541623-56541645 TTATATAAACAGGTTGATTTAGG - Intergenic
1158767011 18:60463470-60463492 TTTTAAAAAAAGTTTTAGTTTGG + Intergenic
1158812816 18:61057387-61057409 TTATCTATAAAGTTAGGGTTGGG + Intergenic
1159206961 18:65265415-65265437 TTTTTTAAAAAGTTGGGGGTTGG + Intergenic
1159546743 18:69849124-69849146 TTATATTAAAAGATGGAGTTAGG - Intronic
1160331837 18:78000396-78000418 TTATATAAAATGTATGAATTTGG - Intergenic
1160576637 18:79858295-79858317 TTATATAAAATGTCCGAGCTGGG - Intergenic
1163511353 19:17737112-17737134 TTAAAAAAAAAGTTGCAGTTTGG - Intergenic
1163953957 19:20616854-20616876 ATATATAAAAAATAGGAGATTGG + Intronic
1168418788 19:56186968-56186990 TTATGTAAAACGTTGCACTTTGG - Intergenic
1202685067 1_KI270712v1_random:41762-41784 TTATATAAAAATTTGGAGATGGG - Intergenic
925230756 2:2231747-2231769 ATATATAAAAAATTGGTTTTTGG - Intronic
925393364 2:3514492-3514514 TTCTTTAAAAAGTAGGAGATGGG - Intronic
928960559 2:36921642-36921664 TTATATAAAAATTTGGAGATGGG - Intronic
929363633 2:41125159-41125181 TAATATTGAAAGTTGAAGTTTGG - Intergenic
929380502 2:41345151-41345173 TTAAATAAAAATTTAAAGTTTGG + Intergenic
929534606 2:42773153-42773175 TTATAGAGAAATATGGAGTTAGG - Intronic
930076320 2:47408696-47408718 GTTTTTAAAAAGTTGCAGTTTGG + Intronic
930099782 2:47594442-47594464 TGATAGAAAAAAATGGAGTTGGG + Intergenic
932101398 2:68902987-68903009 TGAAATAAAAAGTTGGTATTTGG + Intergenic
933279613 2:80318491-80318513 CTATATAAAGAGTGGGAGTTGGG + Intronic
933402405 2:81815304-81815326 TTAAATAAAAAATTGGAATTTGG + Intergenic
933546499 2:83719729-83719751 TTAGAAATAAAGTTGGAGTCAGG - Intergenic
933568975 2:83985794-83985816 TTAGATATAAAGATGGAGATAGG - Intergenic
934246652 2:90313095-90313117 TTATATAAAAATTTGGAGATGGG + Intergenic
935443215 2:103126838-103126860 TTATAGAAAACATTGGAGTATGG + Intergenic
936729421 2:115361919-115361941 TAATATGAAAATTTGGAGTTGGG - Intronic
938128648 2:128692428-128692450 CTCTTTAAAAAGATGGAGTTAGG + Intergenic
939172893 2:138716160-138716182 CTATTTAAAAAAATGGAGTTCGG - Intronic
939929133 2:148210203-148210225 TTATTTAAAATGTAGGAATTAGG - Intronic
940507452 2:154574522-154574544 TTATATAAAATATTGTATTTAGG + Intergenic
941486610 2:166089689-166089711 CTATATAAAAAGATGGAATGGGG + Intronic
941911955 2:170772004-170772026 TTAAAAAATAAGTTGGATTTGGG - Intergenic
942256845 2:174110880-174110902 TTATATAAAACGTTGCAATTAGG - Intronic
942706358 2:178777048-178777070 TTCTATAAAAAGTTGGGGGAGGG + Exonic
943113272 2:183634375-183634397 TTAAATAAAAAGTTAGAATATGG - Intergenic
943869164 2:192971543-192971565 TGATATAAAAAGTAGTAGGTAGG + Intergenic
944447825 2:199809221-199809243 TCCTATAAAAAGATTGAGTTCGG + Intronic
945462935 2:210132201-210132223 TTACATAAAATGTTTGACTTTGG - Intronic
946100833 2:217320226-217320248 TTACATAAATACATGGAGTTAGG - Intronic
946592854 2:221270495-221270517 TTTTAAAAAAAGTTTGAGGTTGG - Intergenic
946960631 2:224981901-224981923 TAAGAGAAAAATTTGGAGTTTGG - Intronic
947687607 2:232103395-232103417 TTATATTAAAAGTTTCTGTTGGG + Intronic
1168786515 20:544239-544261 TTCTATTCAAACTTGGAGTTCGG + Intergenic
1169653190 20:7892627-7892649 TTATATAGATGGTTGGAATTGGG - Intronic
1169793072 20:9431997-9432019 TTCTATAAAAAGATGAATTTAGG - Intronic
1170148885 20:13206973-13206995 CTATATAAAATCTTGCAGTTGGG - Intergenic
1170659329 20:18321365-18321387 TTATATAAATAGTGGGTTTTTGG + Intergenic
1171336624 20:24391024-24391046 TTATATATAAAATTGGTGCTTGG - Intergenic
1174910871 20:54606263-54606285 TTAAAAAAAAAGTTTAAGTTAGG - Intronic
1176038413 20:63051592-63051614 TTGTATAAAAAGTTAAATTTTGG - Intergenic
1176845222 21:13871432-13871454 TAATCCAAAATGTTGGAGTTGGG - Intergenic
1177045484 21:16163656-16163678 TTATATAAAAATTTTGGGGTGGG + Intergenic
1177112507 21:17045634-17045656 TTATATTTAAAAATGGAGTTAGG - Intergenic
1177188791 21:17826472-17826494 TGACATAAAAAGTTGGACATGGG + Intergenic
1178139959 21:29671382-29671404 TTCTATTTAAAGTTGGAGTTGGG - Intronic
1178815103 21:35922066-35922088 TGATATAAAGAGCTGGAGTTGGG - Intronic
1179426860 21:41287288-41287310 TTCTTTAGAAACTTGGAGTTGGG - Intergenic
1180165656 21:46025541-46025563 TTATGTCAAAACTTGGAGTGGGG - Intergenic
1182443774 22:30378863-30378885 TTTTTTAAAGAGTTGGAGTAGGG - Exonic
1183132165 22:35848846-35848868 GTATATAAAATGAAGGAGTTGGG - Intronic
1183837745 22:40470216-40470238 ATATATAAAATTTTGGAGATGGG - Intronic
949140887 3:631515-631537 GTATATAAAAATTTTGAGTGGGG + Intergenic
949553149 3:5129355-5129377 TCATATATAAAGTTGGACTTTGG + Intronic
950727621 3:14927321-14927343 TTATTTTAAAAGGTGGATTTAGG + Intronic
951142089 3:19174499-19174521 TTATTTAAAAAGTTCTAATTTGG + Intronic
951264618 3:20551579-20551601 TTATTCAGAAAGTTTGAGTTGGG - Intergenic
952302656 3:32117671-32117693 TTATCTAAAAAGTTTGTGCTAGG + Intronic
952691685 3:36214171-36214193 TTATTTAAAAATTTGAATTTTGG - Intergenic
952797415 3:37253421-37253443 TTATAAAATAAGTTGAAGTAAGG + Intronic
952867867 3:37867727-37867749 TTATATAAGACGTTAGCGTTAGG - Intronic
953507845 3:43503961-43503983 TTATATAAAGTGTTGGGGATTGG + Intronic
953731878 3:45456890-45456912 TTACATAAAAAGTAGGGGTGAGG - Intronic
953763543 3:45714428-45714450 TAATTTAAAAAGTTAGACTTAGG + Intronic
955897568 3:63716779-63716801 TTTTATGGAGAGTTGGAGTTAGG - Intergenic
956068769 3:65425176-65425198 TTTTATAAAAAGTTCTAGCTGGG - Intronic
956134179 3:66082605-66082627 TTAGAGAAAAAGGTGGTGTTTGG - Intergenic
956563345 3:70608191-70608213 TTATCTATAAAATTGGAGTAAGG - Intergenic
956970425 3:74517067-74517089 TTGTCTAAAAACTTGGAGTCAGG - Intronic
957413446 3:79870087-79870109 TGATACAAAAAGTTGGCCTTTGG + Intergenic
957742705 3:84292834-84292856 TTTTAAAAATAGTTGGAATTTGG - Intergenic
957793850 3:84976093-84976115 TTATATAAAAAGTATGTCTTGGG + Intronic
957838882 3:85639896-85639918 TCATAAAAAGATTTGGAGTTAGG - Intronic
958186895 3:90133285-90133307 TTATATGCAATGTTGAAGTTTGG - Intergenic
958606884 3:96369908-96369930 TAAAATAAAAAGCTGCAGTTGGG - Intergenic
958626991 3:96639137-96639159 ATATAGGAAAAGTTGAAGTTGGG + Intergenic
958648942 3:96911049-96911071 TTATATGAAAAGCTGTATTTAGG + Intronic
959095962 3:101956190-101956212 TTATATAACAAATAGGAATTTGG - Intergenic
959312464 3:104756583-104756605 TAAAATCAAAAGTTGCAGTTGGG - Intergenic
960352818 3:116613885-116613907 TGATATTAAAAGTTGCTGTTTGG - Intronic
961072673 3:123949656-123949678 TGAAATGAAAAATTGGAGTTGGG - Intronic
961600870 3:128060847-128060869 TTATATGAAAAGTGCAAGTTAGG - Intronic
962516723 3:136159174-136159196 TTATAGTAAAATTTGGAATTTGG - Intronic
964065488 3:152573520-152573542 TTATCTAAAAAGTTGGTTCTTGG - Intergenic
964333841 3:155633953-155633975 TTAAAAAAAAAGATGGAGTCAGG - Intronic
964372986 3:156020462-156020484 TTACATGACAACTTGGAGTTAGG - Intergenic
964915049 3:161830342-161830364 TTAAATAAAATATTGGAGTTGGG + Intergenic
965634917 3:170771066-170771088 ATATTTAAAATGTTGGACTTTGG + Intronic
966826618 3:183970341-183970363 TTATTTAAAAAGTAGTATTTGGG - Intronic
967017775 3:185497255-185497277 TTATCTAAAAAGTGAGAGGTTGG + Intronic
967437853 3:189471441-189471463 TTATGTAAAATGTTGGGATTAGG - Intergenic
968114003 3:196075121-196075143 TTATAGAAAACATTGAAGTTTGG + Intronic
968319318 3:197750877-197750899 TTATATAAAAACCGGGAGGTTGG + Intronic
970121714 4:12760975-12760997 TTATTTAAAAATTTGGGATTTGG - Intergenic
970486038 4:16525793-16525815 GGATATGAAATGTTGGAGTTGGG + Intronic
970754865 4:19413733-19413755 TGAGAAAACAAGTTGGAGTTAGG + Intergenic
970903434 4:21186933-21186955 TTAAATAAAAAGATTGAGCTGGG - Intronic
971702731 4:30000215-30000237 TTGTCTAAAGAGTTTGAGTTTGG - Intergenic
971906776 4:32736311-32736333 CTTTATAACAAGTTGAAGTTAGG - Intergenic
972073694 4:35056417-35056439 TTACACAGAAAGGTGGAGTTGGG + Intergenic
973331585 4:48914930-48914952 TTATATAAAGATATGGAGTGGGG - Intergenic
974146531 4:57954489-57954511 TTATATAAGAACTTTGAGTATGG + Intergenic
974263244 4:59551903-59551925 TTATATAAAAAGTAGTACCTTGG - Intergenic
974646297 4:64697587-64697609 TGAAATACAAAGTTGGATTTGGG - Intergenic
975114946 4:70670087-70670109 TAAAATAAAAAGTTGGACATAGG - Intronic
975598433 4:76073376-76073398 TTTTTTAAAAAGCAGGAGTTTGG - Intronic
975863025 4:78697993-78698015 TGATATACAAAGATGGAATTTGG - Intergenic
975909783 4:79253301-79253323 GAATATAAAAATGTGGAGTTTGG + Intronic
975957023 4:79853358-79853380 GTAAAGAAAAAGTTGGAGGTAGG - Intergenic
975996115 4:80317967-80317989 TTATATAAAATGTTCAAGATAGG + Intronic
976882867 4:89950728-89950750 TTATTTAAAAAATTAGAGATGGG + Intronic
977220720 4:94334870-94334892 TTATAAATAAAGTTTGAATTTGG - Intronic
977516836 4:98031222-98031244 TTTTATATAAAGTTAGAGATTGG - Intronic
977782235 4:100993991-100994013 TTATAGAAGGGGTTGGAGTTTGG + Intergenic
978681761 4:111389341-111389363 GTATTTAAAAAATTAGAGTTTGG - Intergenic
978723697 4:111945615-111945637 TTATGTACAAAGTTGGAATTTGG - Intergenic
978983323 4:114979212-114979234 TTATACAAAAAGTTGACATTTGG - Intronic
979946137 4:126833688-126833710 TTTTAAAAAAAATTGGAGCTGGG + Intergenic
979949066 4:126868749-126868771 TTAAATAAAATATTAGAGTTTGG - Intergenic
980715879 4:136628818-136628840 GTATAAAATAAGTAGGAGTTTGG - Intergenic
981227608 4:142314972-142314994 TTAGATAAATAGATGGAGTGAGG - Intronic
981565357 4:146095847-146095869 TTATATAAAAAATTGTGTTTGGG + Intergenic
981949710 4:150391397-150391419 TTATATAAAAAGATTTATTTTGG + Intronic
982508348 4:156249118-156249140 TGATATTAGAAGGTGGAGTTTGG - Intergenic
982672586 4:158339280-158339302 TTTTATTAAAAGTTGAAGATAGG - Intronic
982904574 4:161051498-161051520 TTATTTAAAATGTATGAGTTTGG - Intergenic
982936558 4:161485071-161485093 TTAAATGAATAGTTGTAGTTGGG - Intronic
983123998 4:163927047-163927069 TTAGATAAAAAATTTGATTTGGG + Intronic
983167196 4:164492446-164492468 TTATAGACCAAGTTGGAATTAGG + Intergenic
983916938 4:173302423-173302445 ATATATAGAAAGTTGGGGTGTGG - Intronic
984230094 4:177085888-177085910 TTGTATAAATAGTTGAATTTTGG - Intergenic
984289113 4:177770595-177770617 TTATATAAAAAGTTAGTATCTGG + Intronic
984369578 4:178845583-178845605 TAACATAAAAAGATGGAGTTTGG + Intergenic
984470506 4:180165576-180165598 TTCTATAAAAAGGTGGAGAAGGG - Intergenic
984506263 4:180622640-180622662 TTATATCAAAGGTGGGAGATGGG + Intergenic
984806419 4:183755896-183755918 TTCTTTAAAATGTTGGAATTCGG + Intergenic
985236850 4:187884468-187884490 ACATAGAAAAAGCTGGAGTTGGG + Intergenic
986240511 5:5955479-5955501 TTATATTAAGAGTTGAATTTTGG - Intergenic
986436456 5:7736919-7736941 TTATAAAAAAAATTAGAGTATGG + Intronic
986800208 5:11251809-11251831 ATAAATAAAAACTTGTAGTTTGG + Intronic
986843303 5:11723370-11723392 TTATAGAAAAAATTGCAATTTGG + Intronic
987246634 5:16055492-16055514 ATATATATATAGTTGGAGGTGGG - Intergenic
988250393 5:28749756-28749778 TTATCAAAAATGTTGTAGTTGGG - Intergenic
988331512 5:29847450-29847472 TTATAGAAAAATTTTGATTTGGG - Intergenic
989806040 5:45606491-45606513 TTAGTGAAAAAGCTGGAGTTGGG + Intronic
991135685 5:63179436-63179458 CTATATTGAAAGTTGAAGTTGGG + Intergenic
991391007 5:66143882-66143904 TTTTAAAAATAGTTGGAGTTGGG + Intronic
991721273 5:69496025-69496047 TTGTCTAAAAATTTGAAGTTAGG - Intronic
992167004 5:74063303-74063325 TTATAAAACAAGCTGGAGTAGGG - Intergenic
992241365 5:74773063-74773085 TTATATAAAGACTTGGAATCAGG + Intronic
992520875 5:77549830-77549852 TTATAGAATAATTTGAAGTTGGG - Intronic
992871955 5:81015454-81015476 TTATAAAAAAAGTTGTAATTTGG + Intronic
993160411 5:84283382-84283404 TTATGGAAAAAATTGAAGTTAGG - Intronic
993220564 5:85090902-85090924 ATATAAAAAAAGTTGATGTTGGG + Intergenic
993642230 5:90419135-90419157 TTATATAAAAATGTGCACTTGGG - Intergenic
994195871 5:96922366-96922388 TAATATATTGAGTTGGAGTTGGG + Intronic
994731148 5:103492158-103492180 TTTAATAAAAAGTTTGATTTAGG + Intergenic
995210463 5:109531795-109531817 TTATATCAATATTTGAAGTTGGG + Intergenic
995360905 5:111295871-111295893 ATATAACAAAAATTGGAGTTTGG + Intronic
995797282 5:115955488-115955510 TAACATAAAAAATTGGAGGTGGG - Intergenic
996012531 5:118497153-118497175 TGAAATAAAAAATTGGAGTAGGG + Intergenic
997916712 5:137934049-137934071 TAATTTAAAAAGAGGGAGTTTGG + Intronic
998833161 5:146180727-146180749 TTATACAACAAGTTGGTGTTTGG - Intronic
999353564 5:150902618-150902640 TTATAAAAACAGTTGGAGAATGG + Intronic
999952068 5:156661982-156662004 AAAAATAAAAAGTTGGAGTGGGG + Intronic
1001189844 5:169619551-169619573 TTATATTAAACCTTGAAGTTGGG - Intergenic
1001377816 5:171279463-171279485 CTTTATAAAAAGGTTGAGTTTGG - Intronic
1002152757 5:177249171-177249193 GTATATACAAACTTGAAGTTAGG + Intronic
1002691159 5:181051853-181051875 TTATATAAAAATTTTTAGATGGG + Intronic
1003299382 6:4863288-4863310 TAATATATAAAGCTGGGGTTTGG - Intronic
1003915649 6:10784093-10784115 TTTTATAAAAAGTTGTAATGGGG + Intronic
1004345553 6:14846046-14846068 TCAAATAAAAAGTGGGATTTTGG - Intergenic
1004868580 6:19879173-19879195 TTATATAAGAAGTTAAAATTAGG + Intergenic
1006973309 6:38070043-38070065 TTCTGTAAAAAGTAGGAATTGGG - Intronic
1007029632 6:38616370-38616392 TGTTATAAAAAGTAGGCGTTGGG - Intronic
1007678643 6:43618929-43618951 TAAAATAAAAAGTAGAAGTTGGG - Intronic
1007865394 6:44963702-44963724 TTACAAAAAAAGTTGCAGCTGGG + Intronic
1007912858 6:45533739-45533761 TTAAATAAAAGGTAGTAGTTTGG + Intronic
1009337893 6:62516278-62516300 TTAAAAAAAAAGTTGAAGTAGGG - Intergenic
1009608791 6:65909219-65909241 TTACATATAAATTTGGAGTCAGG + Intergenic
1010110093 6:72217067-72217089 TTATTTAAAATGTTGTATTTTGG + Intronic
1010145768 6:72668104-72668126 TTATATAAGAAGTTGATATTGGG + Intronic
1010839587 6:80632920-80632942 TCATATAAACAGTTGGGTTTGGG - Intergenic
1011442942 6:87407064-87407086 TTATATAAAAATTTCGCATTTGG + Intergenic
1012623181 6:101373784-101373806 TTATTTTAAAATTTGGATTTGGG - Intergenic
1013751445 6:113411429-113411451 TTATTTAAAAATTTAGACTTTGG - Intergenic
1014256531 6:119165797-119165819 TTATATGAAAATTTGGAGTTAGG + Intergenic
1014256986 6:119170305-119170327 TTCTATAAAAAGTTGGAAGTAGG - Intergenic
1014407267 6:121067314-121067336 TTATAAAAAAAGATGAACTTTGG + Intergenic
1014784654 6:125604596-125604618 TTATATTAAATCTTGAAGTTGGG - Intergenic
1014955783 6:127614335-127614357 TTATATACTGAGATGGAGTTCGG + Intergenic
1015382172 6:132581963-132581985 TTCTCTAGAAAGTGGGAGTTAGG + Intergenic
1015750876 6:136557569-136557591 TTATAGAAATAGATGTAGTTAGG + Exonic
1016113552 6:140256156-140256178 CTATATAAAAAGGTGAAATTTGG + Intergenic
1016342297 6:143076565-143076587 TTATTAAAATAGTTGGACTTAGG + Intronic
1016511509 6:144848365-144848387 GCATTTAAAAAGTTGAAGTTGGG + Intronic
1016696684 6:147004362-147004384 TTATATAAAAAAGAGAAGTTGGG - Intergenic
1017738794 6:157386333-157386355 TTATTTAAAAACTTAGAGATGGG - Intronic
1017988337 6:159464150-159464172 TTATATGTAAAAGTGGAGTTGGG - Intergenic
1018307392 6:162472198-162472220 ATAAAAAAAAAGTTTGAGTTTGG - Intronic
1018996409 6:168713791-168713813 ATAAATAAAAAGTTTGATTTAGG - Intergenic
1020390757 7:7655413-7655435 TTAAATGAAAAGTTTCAGTTTGG + Intronic
1021052176 7:16001119-16001141 TAATATAAAAATTTTTAGTTTGG + Intergenic
1021543318 7:21784844-21784866 TGATATGAAAAATTGGATTTGGG - Intronic
1021684268 7:23167480-23167502 TTATATAAACATTTGAAGTATGG + Intronic
1024464888 7:49701534-49701556 TAAAACAAAAAGTTGGAGATGGG - Intergenic
1025730987 7:64107457-64107479 TTAATTAAATAGTTGGAGGTTGG + Intronic
1025846265 7:65200969-65200991 TTCTATAAAATGTGGCAGTTGGG + Intergenic
1025896509 7:65706876-65706898 TTCTATAAAATGTGGCAGTTGGG + Intergenic
1028132490 7:87192602-87192624 CTATATAAAAAATTTGATTTAGG - Intronic
1028171824 7:87606831-87606853 TTTTATAAAAGTTTGGAGATGGG + Intronic
1028313422 7:89368576-89368598 TGAGATAAAAAAATGGAGTTTGG - Intergenic
1028834842 7:95363610-95363632 TTATGTAAAAATTTGGAATGAGG + Intronic
1029208049 7:98880914-98880936 TAATAGACAAAATTGGAGTTGGG + Intronic
1029262983 7:99316030-99316052 TTTTCTAGAATGTTGGAGTTGGG - Intergenic
1029893922 7:103961243-103961265 GTATATAAAAAGATACAGTTTGG - Intronic
1031123971 7:117752299-117752321 TTAGAAAAAATGCTGGAGTTCGG - Intronic
1031128366 7:117801862-117801884 TTATATAAAAATTAAAAGTTTGG + Intronic
1032844927 7:135744350-135744372 TTAAAAATACAGTTGGAGTTTGG - Intronic
1033527150 7:142227557-142227579 TCATGTAAAAAGCTGCAGTTTGG - Intergenic
1033901959 7:146154283-146154305 TTAAAAATAAAATTGGAGTTGGG - Intronic
1034398748 7:150847556-150847578 CTATATACAAAGGTGGAGCTAGG - Intronic
1035006538 7:155666335-155666357 TTACCCAAAAAGTTGGAGTTGGG - Intronic
1035836054 8:2753172-2753194 TTAAATGAAAAGGAGGAGTTAGG + Intergenic
1036079263 8:5536164-5536186 TTCTATAAAAACTTGAATTTGGG + Intergenic
1038252845 8:25922199-25922221 TTATTTGGAAAGTTGAAGTTTGG - Intronic
1039353618 8:36790872-36790894 GTATATAAAAAGTTGCTATTTGG - Intronic
1039589371 8:38733918-38733940 TTTTTTAAAATGTTGGAATTCGG + Intronic
1041448494 8:57980544-57980566 TTTAAAAAAAAGTTGGAATTAGG - Intergenic
1042143012 8:65698521-65698543 TTTTTAAAAAATTTGGAGTTTGG - Intronic
1042415660 8:68514809-68514831 TTACCCAAATAGTTGGAGTTGGG + Intronic
1043068856 8:75612778-75612800 CTATATAAATAGATGGGGTTGGG - Intergenic
1043216709 8:77600890-77600912 TTATTTAAAAACTTGAAATTAGG + Intergenic
1044675473 8:94723619-94723641 TTATATGAAAAGTTAGCTTTAGG + Intronic
1044867442 8:96586191-96586213 TTTTTTAAAAAGCTGGAATTCGG - Intronic
1045407605 8:101882299-101882321 TTATATTAGGAGGTGGAGTTTGG + Intronic
1045890271 8:107147628-107147650 TTATACAATAAGTTGGATTTTGG + Intergenic
1045944176 8:107776690-107776712 TTTAAAAAAAAGTTGGAGTCAGG + Intergenic
1047139571 8:122122594-122122616 TAATGTAAAAAGTTTGAGGTTGG - Intergenic
1047209412 8:122829018-122829040 TTATAGAACAATTTGAAGTTAGG + Intronic
1047352573 8:124089535-124089557 ATTTGTAAAAAGTGGGAGTTTGG - Intronic
1047631999 8:126718126-126718148 CTTTATAGAAAGTTTGAGTTAGG + Intergenic
1047813709 8:128438920-128438942 GTATATAAAATGTTTGGGTTTGG + Intergenic
1047826096 8:128577423-128577445 TTTTATAAAAAGATGGAGAGAGG + Intergenic
1047832733 8:128654360-128654382 TAATATAAATGGTTGGAGTCAGG + Intergenic
1048237880 8:132710007-132710029 TTATATATAAAGTTATATTTTGG + Exonic
1048924853 8:139262332-139262354 TTATATATGAAATTGGATTTGGG + Intergenic
1050631815 9:7567506-7567528 TTAAATAAAAAGATGTTGTTTGG - Intergenic
1051561719 9:18449123-18449145 TTATATAAAAAGCATGAGTTGGG + Intergenic
1051838024 9:21362676-21362698 TTATATTAAAAGTTGTGATTTGG - Intergenic
1051854539 9:21548774-21548796 TGTTATTAAAAGGTGGAGTTTGG - Intergenic
1052186165 9:25597272-25597294 TTATGTAACAACTTGTAGTTAGG - Intergenic
1052905442 9:33829535-33829557 TTTTATAAAAAGTTGATTTTGGG + Intronic
1054852796 9:69865776-69865798 TTATCTATTAAGTTTGAGTTGGG + Intronic
1055443318 9:76357937-76357959 TTAGAAAAGAAGTTGGAATTGGG + Intronic
1055468506 9:76588943-76588965 TTATAGAAAAAGTTTGGGCTGGG - Intergenic
1055540104 9:77294708-77294730 TTTTAAAAAAAATTAGAGTTGGG + Intronic
1055737170 9:79343069-79343091 TTATATAAGAAGATGTATTTGGG - Intergenic
1055767329 9:79678403-79678425 TTAAAAAAAAAGATGAAGTTAGG - Intronic
1055847978 9:80590882-80590904 ATCTATAAAAAGTGGGAATTTGG - Intergenic
1055907806 9:81314350-81314372 TATTATAAAAAGTTGGAGGGAGG - Intergenic
1056156438 9:83843018-83843040 TTCTATAAAAAGTTCAAGTTTGG + Intronic
1056287220 9:85101811-85101833 TTATATAACTAGTTAGACTTTGG - Intergenic
1056354096 9:85780560-85780582 TTCTATAAAAAGTTCAAGTTTGG - Intergenic
1056431051 9:86528258-86528280 TTGTATAAAAAGGTCGAGGTGGG + Intergenic
1057433012 9:95012390-95012412 TTATATAAAATGTTAGAGTTCGG + Intronic
1057788512 9:98106525-98106547 TTGTATAAAAATTTATAGTTAGG - Intronic
1058331000 9:103759691-103759713 ATATATAAAACATTGGAATTAGG + Intergenic
1058370190 9:104257460-104257482 TTATATAAAAAGTAAGAGAAAGG + Intergenic
1059560486 9:115329950-115329972 TTGAATAAAATGATGGAGTTAGG - Intronic
1060014599 9:120075969-120075991 ATATACAATAAGTTGGATTTTGG - Intergenic
1185953454 X:4462343-4462365 ACATATAAAAATTTGGAGTTAGG - Intergenic
1186986700 X:15022607-15022629 TTATATATATATTTGGATTTTGG - Intergenic
1187984391 X:24794410-24794432 TTATATAAGAAGTTATTGTTAGG + Intronic
1188436193 X:30161297-30161319 TTATTTTAAAACTTGGAGGTGGG + Intergenic
1188515958 X:30986200-30986222 TTATATAAATGGTGGGAGTTGGG + Intergenic
1189527767 X:41843274-41843296 TTAAATATAAAGTTAGACTTTGG + Intronic
1190514691 X:51211086-51211108 ATATATAAAAAATTGAAATTAGG - Intergenic
1191721523 X:64232700-64232722 TGATATAAACATTTGGAATTAGG + Intergenic
1192082228 X:68059490-68059512 TTATAAAACAATTTGGCGTTAGG + Intronic
1192422564 X:71046701-71046723 TAATATAAAAAGTGTGATTTTGG + Intergenic
1194242256 X:91465823-91465845 TTATATAAAAGCTTGAGGTTTGG - Intergenic
1194472620 X:94316173-94316195 TACTATTAGAAGTTGGAGTTTGG - Intergenic
1194667963 X:96696490-96696512 TTAGACAAAAAGTTGGAATTAGG + Intronic
1194755137 X:97730489-97730511 TCATGTAAAGAGTTTGAGTTAGG - Intergenic
1194904061 X:99551571-99551593 TTTTTTAAAAAATTGGAGTCGGG + Intergenic
1195160241 X:102163677-102163699 TTATCCCCAAAGTTGGAGTTGGG - Intergenic
1195644811 X:107217986-107218008 TTATATATAAATCTGTAGTTAGG + Intronic
1196598607 X:117574690-117574712 TTGTGTAAAATGATGGAGTTAGG + Intergenic
1200313495 X:155105181-155105203 TTGTTTAAAAAGTTTGTGTTAGG + Intronic
1201717340 Y:17060430-17060452 TTATATATAAAGTTTAAATTTGG + Intergenic
1201736853 Y:17276558-17276580 TTTTATAAAAAATAGTAGTTTGG - Intergenic
1201743632 Y:17348432-17348454 TTATATCAACATCTGGAGTTGGG - Intergenic
1201850763 Y:18477272-18477294 TTATAAAACAAGTTGAAATTGGG + Intergenic
1201882555 Y:18843105-18843127 TTATAAAACAAGTTGAAATTGGG - Intergenic
1202588532 Y:26457687-26457709 TTATATAAAAATTTGGAGATGGG + Intergenic