ID: 1073553479

View in Genome Browser
Species Human (GRCh38)
Location 10:104425718-104425740
Sequence GTGTCCTAGCTGAGGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073553473_1073553479 13 Left 1073553473 10:104425682-104425704 CCAAACCCGTGCAGTCTGTGGTG 0: 1
1: 0
2: 0
3: 3
4: 69
Right 1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG No data
1073553475_1073553479 7 Left 1073553475 10:104425688-104425710 CCGTGCAGTCTGTGGTGAGAAGT 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG No data
1073553474_1073553479 8 Left 1073553474 10:104425687-104425709 CCCGTGCAGTCTGTGGTGAGAAG No data
Right 1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG No data
1073553472_1073553479 14 Left 1073553472 10:104425681-104425703 CCCAAACCCGTGCAGTCTGTGGT 0: 1
1: 0
2: 0
3: 9
4: 96
Right 1073553479 10:104425718-104425740 GTGTCCTAGCTGAGGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073553479 Original CRISPR GTGTCCTAGCTGAGGTTGGT TGG Intronic
No off target data available for this crispr