ID: 1073554629

View in Genome Browser
Species Human (GRCh38)
Location 10:104436825-104436847
Sequence TAGGCTGGTAAGGCAGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073554622_1073554629 15 Left 1073554622 10:104436787-104436809 CCTGCCTGTCATTGAAGGCATAT 0: 1
1: 0
2: 1
3: 12
4: 139
Right 1073554629 10:104436825-104436847 TAGGCTGGTAAGGCAGTCCCTGG No data
1073554623_1073554629 11 Left 1073554623 10:104436791-104436813 CCTGTCATTGAAGGCATATATAG 0: 1
1: 0
2: 0
3: 8
4: 107
Right 1073554629 10:104436825-104436847 TAGGCTGGTAAGGCAGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073554629 Original CRISPR TAGGCTGGTAAGGCAGTCCC TGG Intronic
No off target data available for this crispr