ID: 1073559588

View in Genome Browser
Species Human (GRCh38)
Location 10:104485528-104485550
Sequence GATCAGTGCCTGGCATAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073559584_1073559588 29 Left 1073559584 10:104485476-104485498 CCTGAGGCAGAGGCTGTGTCTTT No data
Right 1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG No data
1073559583_1073559588 30 Left 1073559583 10:104485475-104485497 CCCTGAGGCAGAGGCTGTGTCTT No data
Right 1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073559588 Original CRISPR GATCAGTGCCTGGCATAAAG TGG Intergenic
No off target data available for this crispr