ID: 1073561685

View in Genome Browser
Species Human (GRCh38)
Location 10:104502450-104502472
Sequence TTGTCTCAGCTGATGCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073561685_1073561693 25 Left 1073561685 10:104502450-104502472 CCACATGGCATCAGCTGAGACAA No data
Right 1073561693 10:104502498-104502520 CTTGTCAACTCTGTGATCTGTGG No data
1073561685_1073561696 30 Left 1073561685 10:104502450-104502472 CCACATGGCATCAGCTGAGACAA No data
Right 1073561696 10:104502503-104502525 CAACTCTGTGATCTGTGGGTGGG No data
1073561685_1073561694 26 Left 1073561685 10:104502450-104502472 CCACATGGCATCAGCTGAGACAA No data
Right 1073561694 10:104502499-104502521 TTGTCAACTCTGTGATCTGTGGG No data
1073561685_1073561695 29 Left 1073561685 10:104502450-104502472 CCACATGGCATCAGCTGAGACAA No data
Right 1073561695 10:104502502-104502524 TCAACTCTGTGATCTGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073561685 Original CRISPR TTGTCTCAGCTGATGCCATG TGG (reversed) Intergenic
No off target data available for this crispr