ID: 1073561695 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:104502502-104502524 |
Sequence | TCAACTCTGTGATCTGTGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073561685_1073561695 | 29 | Left | 1073561685 | 10:104502450-104502472 | CCACATGGCATCAGCTGAGACAA | No data | ||
Right | 1073561695 | 10:104502502-104502524 | TCAACTCTGTGATCTGTGGGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073561695 | Original CRISPR | TCAACTCTGTGATCTGTGGG TGG | Intergenic | ||
No off target data available for this crispr |