ID: 1073561696

View in Genome Browser
Species Human (GRCh38)
Location 10:104502503-104502525
Sequence CAACTCTGTGATCTGTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073561685_1073561696 30 Left 1073561685 10:104502450-104502472 CCACATGGCATCAGCTGAGACAA No data
Right 1073561696 10:104502503-104502525 CAACTCTGTGATCTGTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073561696 Original CRISPR CAACTCTGTGATCTGTGGGT GGG Intergenic
No off target data available for this crispr