ID: 1073562445

View in Genome Browser
Species Human (GRCh38)
Location 10:104508295-104508317
Sequence GGCAACATTCTGATTCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073562445_1073562451 22 Left 1073562445 10:104508295-104508317 CCATCCTGAATCAGAATGTTGCC No data
Right 1073562451 10:104508340-104508362 AAAAAGGTTGGATATTCACAAGG No data
1073562445_1073562450 10 Left 1073562445 10:104508295-104508317 CCATCCTGAATCAGAATGTTGCC No data
Right 1073562450 10:104508328-104508350 AGAATAAGAGCAAAAAAGGTTGG No data
1073562445_1073562449 6 Left 1073562445 10:104508295-104508317 CCATCCTGAATCAGAATGTTGCC No data
Right 1073562449 10:104508324-104508346 GTGCAGAATAAGAGCAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073562445 Original CRISPR GGCAACATTCTGATTCAGGA TGG (reversed) Intergenic
No off target data available for this crispr