ID: 1073562448 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:104508316-104508338 |
Sequence | GCTCTTATTCTGCACTCCTC AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1073562448_1073562451 | 1 | Left | 1073562448 | 10:104508316-104508338 | CCTGAGGAGTGCAGAATAAGAGC | No data | ||
Right | 1073562451 | 10:104508340-104508362 | AAAAAGGTTGGATATTCACAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1073562448 | Original CRISPR | GCTCTTATTCTGCACTCCTC AGG (reversed) | Intergenic | ||