ID: 1073562448

View in Genome Browser
Species Human (GRCh38)
Location 10:104508316-104508338
Sequence GCTCTTATTCTGCACTCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073562448_1073562451 1 Left 1073562448 10:104508316-104508338 CCTGAGGAGTGCAGAATAAGAGC No data
Right 1073562451 10:104508340-104508362 AAAAAGGTTGGATATTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073562448 Original CRISPR GCTCTTATTCTGCACTCCTC AGG (reversed) Intergenic
No off target data available for this crispr