ID: 1073562451

View in Genome Browser
Species Human (GRCh38)
Location 10:104508340-104508362
Sequence AAAAAGGTTGGATATTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073562446_1073562451 18 Left 1073562446 10:104508299-104508321 CCTGAATCAGAATGTTGCCTGAG No data
Right 1073562451 10:104508340-104508362 AAAAAGGTTGGATATTCACAAGG No data
1073562445_1073562451 22 Left 1073562445 10:104508295-104508317 CCATCCTGAATCAGAATGTTGCC No data
Right 1073562451 10:104508340-104508362 AAAAAGGTTGGATATTCACAAGG No data
1073562448_1073562451 1 Left 1073562448 10:104508316-104508338 CCTGAGGAGTGCAGAATAAGAGC No data
Right 1073562451 10:104508340-104508362 AAAAAGGTTGGATATTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073562451 Original CRISPR AAAAAGGTTGGATATTCACA AGG Intergenic
No off target data available for this crispr