ID: 1073563497

View in Genome Browser
Species Human (GRCh38)
Location 10:104516578-104516600
Sequence CTGGGTTAGCTTGAAGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073563489_1073563497 -3 Left 1073563489 10:104516558-104516580 CCCAGAGGATGGGACTTGGGCTG No data
Right 1073563497 10:104516578-104516600 CTGGGTTAGCTTGAAGTGGGGGG No data
1073563490_1073563497 -4 Left 1073563490 10:104516559-104516581 CCAGAGGATGGGACTTGGGCTGG No data
Right 1073563497 10:104516578-104516600 CTGGGTTAGCTTGAAGTGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073563497 Original CRISPR CTGGGTTAGCTTGAAGTGGG GGG Intergenic
No off target data available for this crispr