ID: 1073567971

View in Genome Browser
Species Human (GRCh38)
Location 10:104551806-104551828
Sequence GCACCATGTTTCGCTGCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073567969_1073567971 -9 Left 1073567969 10:104551792-104551814 CCTTCCTGCTGTTAGCACCATGT No data
Right 1073567971 10:104551806-104551828 GCACCATGTTTCGCTGCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073567971 Original CRISPR GCACCATGTTTCGCTGCACC TGG Intergenic
No off target data available for this crispr