ID: 1073568107

View in Genome Browser
Species Human (GRCh38)
Location 10:104553094-104553116
Sequence GACAGGGGTAACACGCCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073568107_1073568109 -8 Left 1073568107 10:104553094-104553116 CCAGAGGGCGTGTTACCCCTGTC No data
Right 1073568109 10:104553109-104553131 CCCCTGTCCCATAGCATTTTAGG No data
1073568107_1073568112 -5 Left 1073568107 10:104553094-104553116 CCAGAGGGCGTGTTACCCCTGTC No data
Right 1073568112 10:104553112-104553134 CTGTCCCATAGCATTTTAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073568107 Original CRISPR GACAGGGGTAACACGCCCTC TGG (reversed) Intergenic
No off target data available for this crispr