ID: 1073568948

View in Genome Browser
Species Human (GRCh38)
Location 10:104559813-104559835
Sequence CTTGCCAGTAGCAGGAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073568948_1073568954 5 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG No data
1073568948_1073568951 -10 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568951 10:104559826-104559848 TACTGGCAAGCAGTGGATTCAGG No data
1073568948_1073568952 -5 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568952 10:104559831-104559853 GCAAGCAGTGGATTCAGGAGTGG No data
1073568948_1073568953 2 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568953 10:104559838-104559860 GTGGATTCAGGAGTGGCTCCAGG No data
1073568948_1073568955 10 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568955 10:104559846-104559868 AGGAGTGGCTCCAGGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073568948 Original CRISPR CTTGCCAGTAGCAGGAACTC AGG (reversed) Intergenic
No off target data available for this crispr