ID: 1073568950

View in Genome Browser
Species Human (GRCh38)
Location 10:104559821-104559843
Sequence ATCCACTGCTTGCCAGTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073568950_1073568954 -3 Left 1073568950 10:104559821-104559843 CCTGCTACTGGCAAGCAGTGGAT No data
Right 1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG No data
1073568950_1073568953 -6 Left 1073568950 10:104559821-104559843 CCTGCTACTGGCAAGCAGTGGAT No data
Right 1073568953 10:104559838-104559860 GTGGATTCAGGAGTGGCTCCAGG No data
1073568950_1073568955 2 Left 1073568950 10:104559821-104559843 CCTGCTACTGGCAAGCAGTGGAT No data
Right 1073568955 10:104559846-104559868 AGGAGTGGCTCCAGGAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073568950 Original CRISPR ATCCACTGCTTGCCAGTAGC AGG (reversed) Intergenic