ID: 1073568954

View in Genome Browser
Species Human (GRCh38)
Location 10:104559841-104559863
Sequence GATTCAGGAGTGGCTCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073568950_1073568954 -3 Left 1073568950 10:104559821-104559843 CCTGCTACTGGCAAGCAGTGGAT No data
Right 1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG No data
1073568948_1073568954 5 Left 1073568948 10:104559813-104559835 CCTGAGTTCCTGCTACTGGCAAG No data
Right 1073568954 10:104559841-104559863 GATTCAGGAGTGGCTCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073568954 Original CRISPR GATTCAGGAGTGGCTCCAGG AGG Intergenic
No off target data available for this crispr