ID: 1073571051

View in Genome Browser
Species Human (GRCh38)
Location 10:104581483-104581505
Sequence TGGGATGCTCTGTGAGGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073571040_1073571051 21 Left 1073571040 10:104581439-104581461 CCATGAGGAGTCCAAGCCCGCGG No data
Right 1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG No data
1073571043_1073571051 10 Left 1073571043 10:104581450-104581472 CCAAGCCCGCGGGTAGTGTGACC No data
Right 1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG No data
1073571045_1073571051 4 Left 1073571045 10:104581456-104581478 CCGCGGGTAGTGTGACCTGTCTT No data
Right 1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG No data
1073571039_1073571051 28 Left 1073571039 10:104581432-104581454 CCAAGTACCATGAGGAGTCCAAG No data
Right 1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG No data
1073571044_1073571051 5 Left 1073571044 10:104581455-104581477 CCCGCGGGTAGTGTGACCTGTCT No data
Right 1073571051 10:104581483-104581505 TGGGATGCTCTGTGAGGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073571051 Original CRISPR TGGGATGCTCTGTGAGGAAC AGG Intergenic
No off target data available for this crispr