ID: 1073573001

View in Genome Browser
Species Human (GRCh38)
Location 10:104596693-104596715
Sequence GTACCCTCCTTGGACAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073572997_1073573001 18 Left 1073572997 10:104596652-104596674 CCAGGGCTCCAGGAACTGGACTT No data
Right 1073573001 10:104596693-104596715 GTACCCTCCTTGGACAGAACTGG No data
1073572996_1073573001 21 Left 1073572996 10:104596649-104596671 CCTCCAGGGCTCCAGGAACTGGA No data
Right 1073573001 10:104596693-104596715 GTACCCTCCTTGGACAGAACTGG No data
1073572998_1073573001 10 Left 1073572998 10:104596660-104596682 CCAGGAACTGGACTTCTACTGCT No data
Right 1073573001 10:104596693-104596715 GTACCCTCCTTGGACAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073573001 Original CRISPR GTACCCTCCTTGGACAGAAC TGG Intergenic
No off target data available for this crispr