ID: 1073575446

View in Genome Browser
Species Human (GRCh38)
Location 10:104618930-104618952
Sequence AGGGAGCTGGTACCATTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073575446_1073575450 -9 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575450 10:104618944-104618966 CAGCTCCCTGGAATGGAGATTGG No data
1073575446_1073575455 13 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575455 10:104618966-104618988 GACCCAAGCTACTTAAAGGAGGG No data
1073575446_1073575459 19 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575459 10:104618972-104618994 AGCTACTTAAAGGAGGGCGGTGG No data
1073575446_1073575461 27 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575461 10:104618980-104619002 AAAGGAGGGCGGTGGTCTGAGGG No data
1073575446_1073575458 16 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575458 10:104618969-104618991 CCAAGCTACTTAAAGGAGGGCGG No data
1073575446_1073575453 9 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575453 10:104618962-104618984 ATTGGACCCAAGCTACTTAAAGG No data
1073575446_1073575454 12 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575454 10:104618965-104618987 GGACCCAAGCTACTTAAAGGAGG No data
1073575446_1073575460 26 Left 1073575446 10:104618930-104618952 CCTGTTAATGGTACCAGCTCCCT No data
Right 1073575460 10:104618979-104619001 TAAAGGAGGGCGGTGGTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073575446 Original CRISPR AGGGAGCTGGTACCATTAAC AGG (reversed) Intergenic