ID: 1073576554

View in Genome Browser
Species Human (GRCh38)
Location 10:104630942-104630964
Sequence TTACGTCCGCCGTGGTGCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073576551_1073576554 -5 Left 1073576551 10:104630924-104630946 CCAAGGATGCCATCTCTCTTACG No data
Right 1073576554 10:104630942-104630964 TTACGTCCGCCGTGGTGCTCCGG No data
1073576549_1073576554 13 Left 1073576549 10:104630906-104630928 CCACGCTTGAACAACTTGCCAAG No data
Right 1073576554 10:104630942-104630964 TTACGTCCGCCGTGGTGCTCCGG No data
1073576548_1073576554 30 Left 1073576548 10:104630889-104630911 CCTCTTTGCTCTCTCTGCCACGC No data
Right 1073576554 10:104630942-104630964 TTACGTCCGCCGTGGTGCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073576554 Original CRISPR TTACGTCCGCCGTGGTGCTC CGG Intergenic
No off target data available for this crispr