ID: 1073576865

View in Genome Browser
Species Human (GRCh38)
Location 10:104633389-104633411
Sequence TCTTTTCTTTAGGAGGTAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073576860_1073576865 1 Left 1073576860 10:104633365-104633387 CCTGGAATTCACCAACCATAATT No data
Right 1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG No data
1073576855_1073576865 26 Left 1073576855 10:104633340-104633362 CCCAACCTTGCTACTTGAACACA No data
Right 1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG No data
1073576856_1073576865 25 Left 1073576856 10:104633341-104633363 CCAACCTTGCTACTTGAACACAG No data
Right 1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG No data
1073576861_1073576865 -10 Left 1073576861 10:104633376-104633398 CCAACCATAATTTTCTTTTCTTT No data
Right 1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG No data
1073576858_1073576865 21 Left 1073576858 10:104633345-104633367 CCTTGCTACTTGAACACAGGCCT No data
Right 1073576865 10:104633389-104633411 TCTTTTCTTTAGGAGGTAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073576865 Original CRISPR TCTTTTCTTTAGGAGGTAAA TGG Intergenic
No off target data available for this crispr