ID: 1073577860

View in Genome Browser
Species Human (GRCh38)
Location 10:104640633-104640655
Sequence GGGAGCGGCGAGCAGAGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073577847_1073577860 16 Left 1073577847 10:104640594-104640616 CCTTGGGTGGCGGGGTTTGGCCG No data
Right 1073577860 10:104640633-104640655 GGGAGCGGCGAGCAGAGTCCAGG No data
1073577855_1073577860 -4 Left 1073577855 10:104640614-104640636 CCGGGAGCCGGCCGGGCCAGGGA No data
Right 1073577860 10:104640633-104640655 GGGAGCGGCGAGCAGAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073577860 Original CRISPR GGGAGCGGCGAGCAGAGTCC AGG Intergenic
No off target data available for this crispr