ID: 1073578007

View in Genome Browser
Species Human (GRCh38)
Location 10:104641292-104641314
Sequence ACACTCGGCAGCCCGAGCCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 51}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073577994_1073578007 12 Left 1073577994 10:104641257-104641279 CCCCCGCGCCGGACCCGCACCTC 0: 1
1: 0
2: 0
3: 35
4: 385
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073578004_1073578007 -7 Left 1073578004 10:104641276-104641298 CCTCGGCGGGCGCCACACACTCG 0: 1
1: 0
2: 0
3: 4
4: 59
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073578001_1073578007 4 Left 1073578001 10:104641265-104641287 CCGGACCCGCACCTCGGCGGGCG 0: 1
1: 0
2: 1
3: 11
4: 75
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073577998_1073578007 9 Left 1073577998 10:104641260-104641282 CCGCGCCGGACCCGCACCTCGGC 0: 1
1: 0
2: 0
3: 13
4: 149
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073578003_1073578007 -2 Left 1073578003 10:104641271-104641293 CCGCACCTCGGCGGGCGCCACAC 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073577995_1073578007 11 Left 1073577995 10:104641258-104641280 CCCCGCGCCGGACCCGCACCTCG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073577993_1073578007 13 Left 1073577993 10:104641256-104641278 CCCCCCGCGCCGGACCCGCACCT 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073577991_1073578007 27 Left 1073577991 10:104641242-104641264 CCGGCGCGCGCACACCCCCCGCG 0: 1
1: 0
2: 2
3: 17
4: 212
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073577996_1073578007 10 Left 1073577996 10:104641259-104641281 CCCGCGCCGGACCCGCACCTCGG 0: 1
1: 0
2: 1
3: 12
4: 148
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1073578002_1073578007 -1 Left 1073578002 10:104641270-104641292 CCCGCACCTCGGCGGGCGCCACA 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1073578007 10:104641292-104641314 ACACTCGGCAGCCCGAGCCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073578007 Original CRISPR ACACTCGGCAGCCCGAGCCG CGG Exonic