ID: 1073578417

View in Genome Browser
Species Human (GRCh38)
Location 10:104642935-104642957
Sequence CCCGCAGCGCGTGCCCGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073578412_1073578417 -6 Left 1073578412 10:104642918-104642940 CCTGGCAGCTGCAGCGGCCCGCA 0: 1
1: 0
2: 1
3: 22
4: 256
Right 1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG No data
1073578411_1073578417 -2 Left 1073578411 10:104642914-104642936 CCTGCCTGGCAGCTGCAGCGGCC 0: 1
1: 0
2: 3
3: 48
4: 512
Right 1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG No data
1073578407_1073578417 15 Left 1073578407 10:104642897-104642919 CCCGACTGAGCATCGCGCCTGCC 0: 1
1: 0
2: 0
3: 5
4: 64
Right 1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG No data
1073578408_1073578417 14 Left 1073578408 10:104642898-104642920 CCGACTGAGCATCGCGCCTGCCT 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG No data
1073578406_1073578417 27 Left 1073578406 10:104642885-104642907 CCGAACTGGGCGCCCGACTGAGC 0: 1
1: 0
2: 0
3: 4
4: 109
Right 1073578417 10:104642935-104642957 CCCGCAGCGCGTGCCCGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073578417 Original CRISPR CCCGCAGCGCGTGCCCGGAG GGG Intronic
No off target data available for this crispr