ID: 1073578677

View in Genome Browser
Species Human (GRCh38)
Location 10:104644552-104644574
Sequence AGCCAGGGTGAAGAGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073578667_1073578677 19 Left 1073578667 10:104644510-104644532 CCCCCTTTCCTGATGGCAGGAAA 0: 1
1: 0
2: 1
3: 14
4: 246
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data
1073578665_1073578677 24 Left 1073578665 10:104644505-104644527 CCTGTCCCCCTTTCCTGATGGCA 0: 1
1: 0
2: 0
3: 17
4: 251
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data
1073578668_1073578677 18 Left 1073578668 10:104644511-104644533 CCCCTTTCCTGATGGCAGGAAAA 0: 1
1: 0
2: 3
3: 27
4: 331
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data
1073578669_1073578677 17 Left 1073578669 10:104644512-104644534 CCCTTTCCTGATGGCAGGAAAAG 0: 1
1: 0
2: 2
3: 36
4: 330
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data
1073578670_1073578677 16 Left 1073578670 10:104644513-104644535 CCTTTCCTGATGGCAGGAAAAGA 0: 1
1: 0
2: 1
3: 29
4: 301
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data
1073578672_1073578677 11 Left 1073578672 10:104644518-104644540 CCTGATGGCAGGAAAAGAAGGTG 0: 1
1: 0
2: 3
3: 22
4: 301
Right 1073578677 10:104644552-104644574 AGCCAGGGTGAAGAGTGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073578677 Original CRISPR AGCCAGGGTGAAGAGTGATG GGG Intronic
No off target data available for this crispr