ID: 1073584810

View in Genome Browser
Species Human (GRCh38)
Location 10:104699597-104699619
Sequence GTGTGGAAGTAGGAATATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073584804_1073584810 23 Left 1073584804 10:104699551-104699573 CCATTGCAGATCTTTGAAAAGAC 0: 1
1: 0
2: 5
3: 33
4: 290
Right 1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG No data
1073584806_1073584810 1 Left 1073584806 10:104699573-104699595 CCTTAGAAAACTACCTTTGGAGA 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073584810 Original CRISPR GTGTGGAAGTAGGAATATGA TGG Intronic
No off target data available for this crispr