ID: 1073596892

View in Genome Browser
Species Human (GRCh38)
Location 10:104809597-104809619
Sequence CAGGAAATGAGTGTGGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073596889_1073596892 16 Left 1073596889 10:104809558-104809580 CCTGGGGTGATTGACTCTTGATT 0: 1
1: 0
2: 1
3: 6
4: 99
Right 1073596892 10:104809597-104809619 CAGGAAATGAGTGTGGTTGCAGG No data
1073596888_1073596892 29 Left 1073596888 10:104809545-104809567 CCTATATTTAAAGCCTGGGGTGA No data
Right 1073596892 10:104809597-104809619 CAGGAAATGAGTGTGGTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073596892 Original CRISPR CAGGAAATGAGTGTGGTTGC AGG Intronic
No off target data available for this crispr