ID: 1073597440

View in Genome Browser
Species Human (GRCh38)
Location 10:104815061-104815083
Sequence AGACAAACAGCACTGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073597436_1073597440 15 Left 1073597436 10:104815023-104815045 CCTGTTCTCAAGAAGCTTGCAGT 0: 1
1: 5
2: 21
3: 155
4: 782
Right 1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG No data
1073597435_1073597440 16 Left 1073597435 10:104815022-104815044 CCCTGTTCTCAAGAAGCTTGCAG 0: 1
1: 1
2: 26
3: 160
4: 801
Right 1073597440 10:104815061-104815083 AGACAAACAGCACTGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073597440 Original CRISPR AGACAAACAGCACTGATGGA AGG Intronic
No off target data available for this crispr