ID: 1073597518

View in Genome Browser
Species Human (GRCh38)
Location 10:104815878-104815900
Sequence CTGGAACTACATGGTCTTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 103}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073597518 Original CRISPR CTGGAACTACATGGTCTTAT GGG (reversed) Intronic
906243873 1:44259539-44259561 CTGGAACTACCTTTTCATATTGG - Intronic
910922440 1:92363587-92363609 CTTGAACAACATGGGTTTATGGG + Intronic
918306116 1:183248471-183248493 CTGGATCCACATGGTCTTGAGGG - Exonic
921463534 1:215457843-215457865 ATAGAACTTCAGGGTCTTATGGG + Intergenic
924370380 1:243341665-243341687 CTAATACTACATGATCTTATTGG + Intronic
1064963603 10:20993082-20993104 CTGCAACTACAAAGTCTTTTAGG + Intronic
1072198418 10:93137200-93137222 ATGGATCCACATGGACTTATTGG - Intergenic
1073597518 10:104815878-104815900 CTGGAACTACATGGTCTTATGGG - Intronic
1075848236 10:125564543-125564565 CTGCAACTAGATGGTCCCATCGG + Intergenic
1090599912 11:128359246-128359268 GTAGAAGTACAAGGTCTTATGGG - Intergenic
1094299823 12:28950596-28950618 CTGGAGCTACATGGTGATAATGG - Intergenic
1095645575 12:44542069-44542091 AAGGAACTACATGGCCTAATGGG - Intronic
1099815811 12:87646068-87646090 ATGGAACTCCATAGGCTTATGGG + Intergenic
1106083251 13:26517921-26517943 CTGGAATAACATGTTATTATGGG + Intergenic
1107699634 13:43034828-43034850 CTGGCACTACATGGTGCTCTAGG + Intronic
1111789344 13:92833676-92833698 ATGGAAATACATGGTATTATGGG + Intronic
1113022901 13:105908581-105908603 CAGGAACTGCATGATCGTATTGG + Intergenic
1114051030 14:18920032-18920054 CTTGGACTACATGTTCTGATTGG - Intergenic
1114111528 14:19481890-19481912 CTTGGACTACATGTTCTGATTGG + Intergenic
1119662101 14:76459477-76459499 CTGGAACTCCATGGTCTCCTAGG - Intronic
1119974717 14:79012672-79012694 CTGGATCCAGATGGTCTTCTGGG - Intronic
1121874456 14:97438734-97438756 CTGGAACTACCTGGAACTATTGG + Intergenic
1124514898 15:30359084-30359106 CTGAAACTTTATGGTTTTATTGG - Intergenic
1124728024 15:32171678-32171700 CTGAAACTTTATGGTTTTATTGG + Intronic
1134004796 16:10811159-10811181 CTGGAACTACATAGTAGTAATGG + Intronic
1142604772 17:1075349-1075371 CTGTCACAACCTGGTCTTATGGG - Intronic
1144683668 17:17212189-17212211 TTGTTACTACATGGTTTTATTGG - Intronic
1145213822 17:21036985-21037007 CTGGAACTACACGATGTTCTGGG - Intronic
1153448786 18:5203338-5203360 GTGGAACTAATGGGTCTTATGGG - Intergenic
1153851228 18:9096904-9096926 GTGGAGCTACATGCTCTCATTGG - Intergenic
1154383003 18:13869341-13869363 GTGGAGCTCCATGGTCTTACAGG - Intergenic
1154983640 18:21526845-21526867 CAGGAACTACAAGATTTTATGGG - Intergenic
1155535066 18:26808575-26808597 CAGGAAATACATAGTCTTCTGGG - Intergenic
1155971634 18:32088950-32088972 CTGGAAGCACATGGCCTTACAGG + Intergenic
1159504423 18:69316456-69316478 GTGGAAATACTTGATCTTATAGG - Intergenic
1164518858 19:28961381-28961403 CTGCAACTTCATAGTCTCATTGG + Intergenic
1164645401 19:29855556-29855578 CTGGAACAACATGATCTCTTGGG - Intergenic
1166287662 19:41841944-41841966 CTGACACTACATGGTCAAATTGG + Intronic
929456307 2:42068567-42068589 CTGCATCAGCATGGTCTTATAGG + Intergenic
932047975 2:68369031-68369053 CTGGATCTACCTTGTCTTCTAGG + Intronic
935169238 2:100597734-100597756 CTGGCCCTAAAAGGTCTTATAGG + Intergenic
941311791 2:163941800-163941822 CTGGAACTACATCATTTGATTGG + Intergenic
944140072 2:196446504-196446526 CTGGACCTACATGGTTTTCTTGG + Intronic
947061078 2:226166603-226166625 CTTGATCTTCCTGGTCTTATTGG + Intergenic
947124913 2:226858422-226858444 CAGGAACTACAGAGTCTTAATGG - Intronic
947972365 2:234334891-234334913 CTTGAAGTACAAGGTATTATAGG - Intergenic
1170564879 20:17593519-17593541 GTGGAGATACATGATCTTATGGG + Intronic
1170733559 20:18994230-18994252 CTGAAACTCCAAGGTCTCATAGG - Intergenic
1171304156 20:24090520-24090542 CTGGTACTACAAGGTGTTTTAGG + Intergenic
1173388784 20:42612577-42612599 CTTGAAATACAAGGTCTTTTAGG - Intronic
1174949435 20:55028380-55028402 CTGGTACTCCTGGGTCTTATGGG + Intergenic
1180018484 21:45103454-45103476 CTGCAACTAGATGGTCCCATCGG + Intronic
1180469508 22:15642407-15642429 CTTGGACTACATGTTCTGATTGG - Intergenic
1181119593 22:20657145-20657167 CCTGAACTACATGTTCTGATTGG - Intergenic
1181335180 22:22123759-22123781 CTGGGACTACATGTTCTGATTGG + Intergenic
1185358358 22:50388995-50389017 ATGGAACTATATGATCATATGGG + Intronic
953150823 3:40322784-40322806 CGGGAACTACATGGGCTTGGTGG + Intergenic
953450379 3:43000531-43000553 ATGGAAATGCATGGTCTTGTAGG - Intronic
956606973 3:71082997-71083019 CTGGATCTACGTGGTTTTAAGGG + Intronic
962349884 3:134648962-134648984 TTGGAACAAGCTGGTCTTATTGG + Intronic
969036839 4:4260979-4261001 CTGGGACTACAGGTGCTTATAGG + Intergenic
971771679 4:30905375-30905397 CTGGAACTCCATGGTTCTATAGG + Intronic
971898043 4:32622075-32622097 CTGGAACTAGAGGCTCTCATGGG - Intergenic
973654361 4:53030758-53030780 TTGGAATTACAGGGTCATATAGG - Intronic
974601488 4:64087870-64087892 GTGGAATTACAGGGTCATATGGG + Intergenic
978443150 4:108755694-108755716 CTGGAATTAGCTGGTATTATAGG - Intronic
979582600 4:122378459-122378481 CCGGAAGTAGATGGGCTTATTGG - Intergenic
980588898 4:134857156-134857178 TTGGATCTACATGGACTCATGGG + Intergenic
983816777 4:172139183-172139205 CTGGACCTATAGGATCTTATAGG + Intronic
984406800 4:179342917-179342939 CTGCAACAACATGATTTTATAGG + Intergenic
984926501 4:184811717-184811739 CTGGAACTAGATGGTGGTAATGG + Intronic
986601004 5:9473418-9473440 CAGGGTCTACATGGGCTTATTGG - Intronic
987447449 5:18037766-18037788 CTGCAACTAAATTATCTTATCGG - Intergenic
988434700 5:31160208-31160230 CTGGAGCTTCATGGTCTCAAAGG - Intergenic
989799664 5:45521736-45521758 CTGGAACTCCTTGCTGTTATGGG - Intronic
990110802 5:52321203-52321225 AAGAAACTACATTGTCTTATGGG + Intergenic
993215639 5:85019685-85019707 CTGCAAAAACATGGCCTTATTGG + Intergenic
996331188 5:122330893-122330915 CTGCAACTAGATGGTCCCATTGG + Intronic
996663742 5:126033871-126033893 CTGGAACTTCATGGGGTGATAGG + Intergenic
996705031 5:126489095-126489117 CTTGAAATACATAGTCTTGTAGG + Intronic
999896465 5:156039165-156039187 CAAAAACTAAATGGTCTTATTGG - Intronic
999905657 5:156138430-156138452 CTTCACATACATGGTCTTATGGG + Intronic
1008326146 6:50184533-50184555 CTGGAACTACATGGTTGGAATGG - Intergenic
1008430894 6:51415432-51415454 CTGTAACTAGGTGGTCTTAATGG - Intergenic
1011078552 6:83464127-83464149 CTGGTAATACAGGGCCTTATAGG + Intergenic
1011907940 6:92395823-92395845 CTGCAACTACATTATTTTATTGG + Intergenic
1012321355 6:97850773-97850795 ATGAAACTACATGCTTTTATGGG + Intergenic
1013281295 6:108639456-108639478 CAGAAAGAACATGGTCTTATTGG - Intronic
1013719457 6:113006218-113006240 CTGTAACTATATGATCTTGTTGG - Intergenic
1016785605 6:148007479-148007501 CTGGAAAAAGATGCTCTTATGGG + Intergenic
1018302696 6:162420149-162420171 CTGCAACTAGATGGTCTCATTGG + Intronic
1018701476 6:166430711-166430733 CTGGGACCACAGGGTCCTATGGG + Intronic
1023317548 7:38955743-38955765 CAGGAAGTACATGATCTTAGAGG - Intergenic
1026250021 7:68661766-68661788 CTGCAACTAGATGGTCCCATTGG + Intergenic
1027847551 7:83401508-83401530 CTGAAACCACATGGTCTTAAAGG - Intronic
1032274734 7:130444760-130444782 CTGGAACTAAATGGGCATTTTGG + Intergenic
1044705642 8:95005888-95005910 CTGGAACTGCATTGTCTCCTGGG - Intronic
1047457953 8:125033383-125033405 CTGAAACTGGATAGTCTTATGGG + Intronic
1051323342 9:15935070-15935092 CTGGAACTACATGGTGGTGATGG + Intronic
1051657171 9:19394153-19394175 CTGGGATTACATGGTATTACAGG - Intergenic
1055209145 9:73767904-73767926 CTGGAAGTACAAGGTCATCTTGG - Intergenic
1056090919 9:83204807-83204829 CTAGAACTAAATGATCTTTTTGG - Intergenic
1060539090 9:124417284-124417306 CTGGAATTACATAGTGGTATTGG + Intergenic
1186604460 X:11075978-11076000 CTGGCACTACATGGTGTCACAGG - Intergenic
1190832468 X:54071534-54071556 CTGGAACTCCAGGGTCAAATTGG - Exonic
1193471956 X:81916704-81916726 CTGGAACTACAAGGTTCTCTAGG - Intergenic
1194695093 X:97037790-97037812 CTGCAAATACATGATTTTATTGG + Intronic
1194728613 X:97428227-97428249 CTGAAAATACATTTTCTTATGGG - Intronic
1195618772 X:106933100-106933122 CTGGCACTACATGAGCTTTTGGG + Intronic
1198095905 X:133379479-133379501 CTAGAACTAGATAGTCTTAATGG + Intronic
1201546785 Y:15173985-15174007 CTGGAACTTATTGGTGTTATTGG + Intergenic