ID: 1073599072

View in Genome Browser
Species Human (GRCh38)
Location 10:104829262-104829284
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073599069_1073599072 17 Left 1073599069 10:104829222-104829244 CCTAGAGTCAGAGATGCATGTGC 0: 1
1: 0
2: 1
3: 17
4: 168
Right 1073599072 10:104829262-104829284 CTGGTGAGTAGCAAAATTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr