ID: 1073603029

View in Genome Browser
Species Human (GRCh38)
Location 10:104865225-104865247
Sequence CTGTGTGAAAGAAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073603023_1073603029 15 Left 1073603023 10:104865187-104865209 CCTCACTGCCTAGTGCTGTGTTT 0: 1
1: 0
2: 2
3: 30
4: 347
Right 1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG No data
1073603025_1073603029 7 Left 1073603025 10:104865195-104865217 CCTAGTGCTGTGTTTGGCACATA 0: 1
1: 2
2: 17
3: 130
4: 798
Right 1073603029 10:104865225-104865247 CTGTGTGAAAGAAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073603029 Original CRISPR CTGTGTGAAAGAAGGAAAGA AGG Intronic
No off target data available for this crispr