ID: 1073605752

View in Genome Browser
Species Human (GRCh38)
Location 10:104894211-104894233
Sequence AGAGAAACGCTGCAGTTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073605752_1073605753 -7 Left 1073605752 10:104894211-104894233 CCTCTCAACTGCAGCGTTTCTCT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1073605753 10:104894227-104894249 TTTCTCTCAAATAGTGTTAGAGG No data
1073605752_1073605756 4 Left 1073605752 10:104894211-104894233 CCTCTCAACTGCAGCGTTTCTCT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1073605756 10:104894238-104894260 TAGTGTTAGAGGAGGGAAAAAGG No data
1073605752_1073605755 -3 Left 1073605752 10:104894211-104894233 CCTCTCAACTGCAGCGTTTCTCT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1073605755 10:104894231-104894253 TCTCAAATAGTGTTAGAGGAGGG No data
1073605752_1073605754 -4 Left 1073605752 10:104894211-104894233 CCTCTCAACTGCAGCGTTTCTCT 0: 1
1: 0
2: 0
3: 19
4: 145
Right 1073605754 10:104894230-104894252 CTCTCAAATAGTGTTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073605752 Original CRISPR AGAGAAACGCTGCAGTTGAG AGG (reversed) Intronic
901629877 1:10642851-10642873 AGAGCACCGCGGCAGGTGAGCGG - Exonic
903537662 1:24077615-24077637 TGATAAATGCTGCAATTGAGGGG - Intronic
905029241 1:34870463-34870485 AGAGAAAGGCTGAAGTTGCGGGG - Intronic
905706746 1:40066077-40066099 ATAGAAAAGCTGCCATTGAGCGG + Intronic
907757643 1:57326455-57326477 TGAGAAATCCTGCAGTGGAGAGG - Intronic
908742176 1:67340484-67340506 AGAGAAACCCTTGAGTTGAGAGG - Intronic
917047453 1:170877285-170877307 AAAGATACACTGCAGTTGAAGGG - Intergenic
917241225 1:172950479-172950501 AGAGAAATGCTTGAGTGGAGAGG - Intergenic
919801987 1:201359688-201359710 AGAGCAACGCTGGAGCTGACTGG + Intronic
920982984 1:210855691-210855713 ATAGAAAGGCAGCAGGTGAGTGG - Intronic
921183718 1:212652325-212652347 AGAGAAAACCTGCAGTTCAGAGG - Intergenic
922582679 1:226710441-226710463 AGAGAAACCCTGCAGAAGAAAGG - Intronic
924350471 1:243109491-243109513 AGAGATATGCTGCAGCAGAGGGG - Intergenic
1064121349 10:12622701-12622723 AGACAAACGCTGCCCTGGAGCGG + Intronic
1065183981 10:23155013-23155035 AGAGAAAAGAAGCAGTAGAGGGG + Intergenic
1067065700 10:43102944-43102966 AGGGAAACGCTGAAGAGGAGGGG + Intronic
1068571589 10:58635726-58635748 AGAGAAAGGCTTGAGTTGAGGGG - Intronic
1071131637 10:82400514-82400536 ACAGAAAAGCTGGGGTTGAGAGG + Intronic
1072138875 10:92573171-92573193 AGATCAACGGTGCAGTGGAGAGG + Intronic
1073317445 10:102592941-102592963 AGAGAATGGCTGTAGCTGAGAGG + Intronic
1073605752 10:104894211-104894233 AGAGAAACGCTGCAGTTGAGAGG - Intronic
1073816202 10:107210162-107210184 AGAGAAAATTTGCAGTTGTGAGG + Intergenic
1076217137 10:128704004-128704026 AGAGAGATGCTTCAGTTGTGGGG + Intergenic
1078427259 11:11261907-11261929 TGAGAAACCCTGGAGTGGAGGGG + Intergenic
1080485310 11:32700449-32700471 ATAGAAACACTGCAGTGGAATGG + Intronic
1083929397 11:65832226-65832248 AGAGAGAAGCTGAGGTTGAGTGG - Intronic
1083929408 11:65832394-65832416 AGAGAGAAGCTGAGGTTGAGTGG - Intronic
1083929415 11:65832478-65832500 AGAGAGAAGCTGAGGTTGAGTGG - Intronic
1083929424 11:65832583-65832605 AGAGAGAAGCTGAGGTTGAGTGG - Intronic
1086124066 11:83331885-83331907 AAATAAAGGCTGCAGTTGTGTGG - Intergenic
1089165973 11:116476962-116476984 AGAGAAATGATGCAGCAGAGAGG + Intergenic
1090469468 11:126967427-126967449 AGTGAAAGGCTGCAGTTTGGAGG - Intronic
1090989798 11:131806412-131806434 AGACAAACTCTGGAATTGAGAGG - Intronic
1091599243 12:1908101-1908123 AGAGAAACGGCGCAGGTGAGAGG + Intronic
1094098986 12:26741070-26741092 CGAGGAACTCTGCAATTGAGTGG + Intronic
1095221327 12:39619713-39619735 AGAGAAACGCTGCAGACTATGGG - Exonic
1098329407 12:69337058-69337080 AGAGAAAACCTGGAGTTAAGGGG + Intergenic
1098795591 12:74884712-74884734 AGAGAAAAGTAGCAATTGAGGGG + Intergenic
1110378141 13:74817249-74817271 AGAAAAAGGCTTCAGTTGATGGG + Intergenic
1112298149 13:98207401-98207423 AGAGAAAGGATTCAGTTCAGAGG + Intronic
1114477282 14:23005322-23005344 ACAGAAATGAGGCAGTTGAGAGG + Intronic
1118180415 14:63486774-63486796 AGAGAAAGGCTGGAGTGGAAAGG - Intronic
1118439880 14:65802568-65802590 GGAGAGACCCTGCAGCTGAGGGG + Intergenic
1121151353 14:91638063-91638085 AGGCCAAGGCTGCAGTTGAGAGG - Intronic
1122635693 14:103128664-103128686 AGAGAAAGGGTCCAGTGGAGAGG + Intronic
1123994086 15:25706278-25706300 AGAGAAAGCCTGCAGAGGAGAGG + Intronic
1124843103 15:33263194-33263216 AGAGAAACACTCCTGGTGAGGGG - Intergenic
1127825097 15:62696127-62696149 GGAGAAACACTGCAGTCTAGGGG - Intronic
1128694050 15:69747230-69747252 AGAGAAGCACAGCACTTGAGTGG + Intergenic
1131370452 15:91876686-91876708 AGAGAACAGTTCCAGTTGAGAGG - Intronic
1135933367 16:26758247-26758269 AGAGATGCACTGCAGTTCAGTGG + Intergenic
1136083680 16:27869196-27869218 AGAAAAAGGCTACAGGTGAGTGG + Intronic
1140773014 16:78223367-78223389 TGAGAAACCCTGCACTTGTGTGG + Intronic
1141406377 16:83797258-83797280 GGAGAAACACAGCAGCTGAGTGG + Intronic
1143531814 17:7509490-7509512 TGAGAAAGGCTGCAGCTAAGGGG - Intronic
1146622815 17:34412973-34412995 AGAGCCACACTGCTGTTGAGAGG + Intergenic
1147047846 17:37767961-37767983 AGAGAAACCCTGCCTTTGTGGGG - Intergenic
1147110318 17:38256953-38256975 AGGCAAAGGCTGCAGTTGATGGG + Intergenic
1150531294 17:65985122-65985144 AGAGAGAAGCCGCAGTTGAAGGG + Intronic
1155332117 18:24729005-24729027 AGAGTGAGGCTGCAGTTGGGAGG - Intergenic
1156847108 18:41678997-41679019 AGAGAAATTCTGTAGTTGTGGGG - Intergenic
1157058569 18:44258951-44258973 GGATAAACACTGCAGTTCAGTGG + Intergenic
1157094764 18:44678396-44678418 ATAGGAACGCTGCAGTGAAGTGG - Intergenic
1157520442 18:48341875-48341897 AGAGAAACCCTGCCGTTGGTGGG + Intronic
1157815250 18:50725347-50725369 AGGGGAATGCTGCAGTCGAGGGG - Intronic
1159629350 18:70731431-70731453 AGAGAAACTAAGCACTTGAGGGG + Intergenic
1160450960 18:78965652-78965674 AGAGAAACCCTTCAGCTGTGTGG - Intergenic
1162249116 19:9427663-9427685 AGAGGCAAGCTGCAGCTGAGAGG - Intronic
1162803420 19:13123518-13123540 AGAGAATAGCTGCAGTTGGGAGG + Intronic
1163890349 19:20006889-20006911 AGAGAAACTCTGCATATGTGAGG - Exonic
1164029051 19:21384152-21384174 AGAGAAACGCTACAAATGTGAGG + Intergenic
1166839582 19:45688595-45688617 TGAGAGAGGCTGGAGTTGAGAGG + Intronic
1167661821 19:50799736-50799758 AGAGAAACACTGCTGCTGGGGGG - Intronic
1168524403 19:57077358-57077380 AAAGAAATGCTGAAGTTAAGGGG + Intergenic
925354660 2:3230378-3230400 AAAGACACGCTGCAGCTGAAGGG + Intronic
926793722 2:16601290-16601312 AGAGAAGCCCTCCAGCTGAGGGG + Intronic
927886607 2:26722577-26722599 AGAGGATCTCTGCAGTTTAGTGG - Intronic
928123849 2:28602795-28602817 AGGGAAAAGCTGCAGATGAGAGG - Intronic
928346111 2:30498136-30498158 AGAAAAACTCTGCAACTGAGAGG + Intronic
929876479 2:45800958-45800980 AGAGAAATGCAGCAGTTGCCTGG + Intronic
929934216 2:46282593-46282615 AGAGAAAGGCAGAAGTGGAGAGG - Intergenic
932274837 2:70443944-70443966 AGAGTTATGCTGCAGTGGAGGGG + Intergenic
932480936 2:72038752-72038774 AGAGAGACCCTGGAGCTGAGTGG - Intergenic
935820485 2:106887689-106887711 AGAGACACGCTGAAGTTCACAGG - Intergenic
938171570 2:129081904-129081926 ACAGAAATTCTGGAGTTGAGAGG + Intergenic
940906472 2:159174315-159174337 AGAGATAAGTTGGAGTTGAGAGG - Intronic
942234549 2:173891262-173891284 AGAGAAAAGCTGCAGAAAAGAGG - Intergenic
946027087 2:216678472-216678494 AGAGAAAAGCTGCAGGGGAGGGG - Intronic
947390455 2:229634391-229634413 TGAGAAATGCTGCAGTAGTGTGG - Intronic
947699102 2:232217651-232217673 AGGGAAACGCTTAAGTTTAGTGG + Intronic
1169456262 20:5755078-5755100 AGAGAAATGCTTGAGTTAAGGGG + Intronic
1172802603 20:37587740-37587762 AGAAAAATGCTGCTGTTGAGAGG - Intergenic
1178469598 21:32880451-32880473 AGATAAATGCCGCAGTGGAGGGG + Intergenic
1178501322 21:33127954-33127976 AAAGAAACCCTGCTGATGAGAGG + Intergenic
1182390002 22:29985549-29985571 AGGGAAACACTGCAGTAGAAAGG + Intronic
949938046 3:9132173-9132195 GGAGAAACTGTGCAGTGGAGAGG - Intronic
951013783 3:17706134-17706156 AGGCAAAGGCTGCAGTTGATGGG + Intronic
951864835 3:27296452-27296474 AGAGAAACTCAGCAGATCAGGGG - Intronic
953683845 3:45060847-45060869 AGAGAAACCCAGCATGTGAGAGG - Intergenic
956120278 3:65959253-65959275 AGACAAAGGATGCAGTAGAGAGG - Intronic
956346656 3:68286976-68286998 AGGGAAACACAGCAGTTGTGGGG + Intronic
958541436 3:95480027-95480049 AGAGAAAGGCTGAAGATGTGTGG + Intergenic
958896594 3:99836545-99836567 AGAAAAGAGCGGCAGTTGAGTGG - Intronic
959900545 3:111656860-111656882 CAAGAAATGCTGGAGTTGAGGGG + Intronic
962770189 3:138604271-138604293 GGAGACACGATTCAGTTGAGAGG - Intergenic
965975234 3:174613132-174613154 AGAGAAAAGCTCCATTTGATGGG - Intronic
971171773 4:24240976-24240998 AGAGAAACTCTGCTGCTGAGGGG + Intergenic
971274946 4:25187153-25187175 AGAAAAACTTTACAGTTGAGTGG + Intronic
971378202 4:26072556-26072578 AGAGACAGGCTGCAGTGCAGTGG - Intergenic
972914070 4:43854067-43854089 AGATAAGAGCTGCAGTTTAGAGG + Intergenic
978367626 4:107998626-107998648 AGAGAAGGGCTGGAGTTGAGAGG + Intronic
979989040 4:127352367-127352389 AGTGAAGCACTGCAGCTGAGGGG + Intergenic
981932311 4:150204073-150204095 AGAGAAACACTTCAGCTCAGAGG - Intronic
982285077 4:153725536-153725558 AGAGAAACCCTGCAGTTTAAAGG - Intronic
983930567 4:173449027-173449049 AGAGACAGGCTGAAGTGGAGAGG + Intergenic
984849099 4:184137826-184137848 TCAGAAAAGCAGCAGTTGAGAGG - Intronic
987017720 5:13837279-13837301 AGAGAAACTGTGCTTTTGAGGGG + Intronic
990287067 5:54310713-54310735 AGAGAAACGCGGGAGTGGTGGGG + Intergenic
998331564 5:141332305-141332327 AGAGACACGTTGCTGCTGAGGGG - Exonic
999547241 5:152643176-152643198 ACAGAAAAGCTGGAGTAGAGAGG - Intergenic
1000519881 5:162282340-162282362 AGAGAAATGCAGCAAGTGAGAGG + Intergenic
1000972933 5:167734831-167734853 AGGGAGACGAAGCAGTTGAGAGG - Intronic
1002331375 5:178443133-178443155 AGGGAAACGCTGTAGGTGGGTGG - Intronic
1004436708 6:15602284-15602306 AGAGAAGGGCTGCAGCAGAGAGG + Intronic
1005764279 6:28995579-28995601 AGAGAAACGTTACAGGTGTGAGG - Exonic
1008513400 6:52297903-52297925 AAAGCAACACTGCAGATGAGGGG + Intergenic
1011023353 6:82838752-82838774 AGAGACAGGCTGGAGTAGAGTGG + Intergenic
1012584305 6:100903994-100904016 AGAGAAATGCAGGAGTTGGGAGG - Intergenic
1016128982 6:140442323-140442345 ACAGTAACTCTGCAGTTGAAAGG - Intergenic
1017463436 6:154672643-154672665 ATAGAAGCGCTGGAGTGGAGAGG - Intergenic
1019073567 6:169369159-169369181 AGGGAGACGCAGCATTTGAGTGG + Intergenic
1021574812 7:22097297-22097319 AGAGACAGGCTGCAGTTCAGGGG - Intergenic
1022817143 7:33924535-33924557 AGAGCAAAGCTCCAGTGGAGAGG - Intronic
1025222093 7:57120430-57120452 AGAGAAACCCTGCAGGTGTGAGG - Exonic
1025266878 7:57469172-57469194 AGAGAAACCCTACAGATGTGAGG + Exonic
1025632873 7:63292102-63292124 AGAGAAACCCTGCAGGTGTGAGG - Intergenic
1025649824 7:63456081-63456103 AGAGAAACCCTGCAGGTGTGAGG + Intergenic
1025721111 7:64015476-64015498 AGAGAAACCCTACAGATGTGAGG + Intergenic
1025743235 7:64219762-64219784 AGAGAAACCCTACAGATGTGAGG + Intronic
1025748247 7:64266341-64266363 AGAGAAACCCTACAGATGTGAGG + Exonic
1026176134 7:67998714-67998736 AGAGACACAATGCAGTTTAGAGG - Intergenic
1032882203 7:136101705-136101727 AGAGAAACTTTGCAGTGGAGTGG + Intergenic
1033372024 7:140717850-140717872 AGAGAAAAACTGCAGTTCATAGG + Intronic
1034033359 7:147792094-147792116 AGAGCAAGGCTGCAGGTGAAGGG - Intronic
1034670728 7:152856268-152856290 AGAGAAACACTACGGATGAGGGG - Intergenic
1037414236 8:18631771-18631793 AGAGAAACATTGCAGTGGGGTGG - Intronic
1037568045 8:20134346-20134368 AGTGAAACGATGCATTTAAGAGG + Intergenic
1037834603 8:22208666-22208688 AGAGAAAGGCTGGAGTCCAGGGG + Intronic
1038614082 8:29076757-29076779 TGAGAAAAGGTGCAGTGGAGAGG + Intronic
1041650040 8:60293318-60293340 AGAGAAACACTGGAGTTGTGAGG - Intergenic
1041856668 8:62463944-62463966 AAAGAAAAACTGCAGATGAGGGG + Intronic
1044623883 8:94217553-94217575 AGAGAGCAGCTGCATTTGAGGGG - Intergenic
1047713102 8:127571228-127571250 AGAGAAAGACTGCTTTTGAGAGG - Intergenic
1047727879 8:127700298-127700320 AGAGAAAAGCTGCAGTTGTCTGG - Intergenic
1048383457 8:133889078-133889100 ACAGGAGCGCTGCAGCTGAGTGG + Intergenic
1051361698 9:16286640-16286662 CGAGGAAGGCTGCAGATGAGGGG - Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1060210098 9:121704916-121704938 AGTACAATGCTGCAGTTGAGAGG - Intronic
1187018645 X:15356827-15356849 AAAGAAACTCTGCAGTTTAAAGG + Intronic
1190753293 X:53380539-53380561 AAAGGAAGGCTGCAGTGGAGGGG - Intronic
1194006589 X:88502017-88502039 AGAGACAACCTGCAGTTTAGAGG + Intergenic
1201700825 Y:16879605-16879627 AGAGAAATGCTTGAGTTAAGGGG + Intergenic
1202264328 Y:23002107-23002129 GGAGAAACTCTCCTGTTGAGAGG + Intronic
1202417319 Y:24635849-24635871 GGAGAAACTCTCCTGTTGAGAGG + Intronic
1202453467 Y:25034237-25034259 GGAGAAACTCTCCTGTTGAGAGG - Intronic