ID: 1073605819

View in Genome Browser
Species Human (GRCh38)
Location 10:104894770-104894792
Sequence ATGGAAAAGGAGAAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073605812_1073605819 -4 Left 1073605812 10:104894751-104894773 CCTATTACCAAATTGGGGAATGG 0: 1
1: 0
2: 0
3: 8
4: 123
Right 1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG No data
1073605807_1073605819 20 Left 1073605807 10:104894727-104894749 CCAGGAAGAGTTGTAGGATTTGG 0: 1
1: 0
2: 0
3: 19
4: 180
Right 1073605819 10:104894770-104894792 ATGGAAAAGGAGAAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073605819 Original CRISPR ATGGAAAAGGAGAAGGAGGG AGG Intronic
No off target data available for this crispr