ID: 1073605919

View in Genome Browser
Species Human (GRCh38)
Location 10:104895544-104895566
Sequence GAGTGTGAGCTGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 2, 3: 49, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073605919_1073605925 14 Left 1073605919 10:104895544-104895566 CCAGCATCCCTCAGCTCACACTC 0: 1
1: 0
2: 2
3: 49
4: 422
Right 1073605925 10:104895581-104895603 TTTCACAGCATCTGTGTCTCAGG No data
1073605919_1073605926 15 Left 1073605919 10:104895544-104895566 CCAGCATCCCTCAGCTCACACTC 0: 1
1: 0
2: 2
3: 49
4: 422
Right 1073605926 10:104895582-104895604 TTCACAGCATCTGTGTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073605919 Original CRISPR GAGTGTGAGCTGAGGGATGC TGG (reversed) Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900357106 1:2270298-2270320 GAGTAGGGGCTGAGAGATGCTGG + Intronic
900480215 1:2894568-2894590 GAGTGCTAGCTGAGTGATGTGGG + Intergenic
900822589 1:4900631-4900653 GAGTGGGAGCTGAGGCATTGTGG + Intergenic
900973734 1:6005373-6005395 GAGGGTGAACTGGGGGATGTGGG + Intronic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901946796 1:12710863-12710885 GAATATGAGCTGAGTGATCCTGG + Intergenic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902230343 1:15023531-15023553 GAATGTGAGCTGGGGGAGGATGG + Intronic
902490625 1:16778250-16778272 GAGAGTGGACTGAGGGATGAGGG + Intronic
902781534 1:18708189-18708211 GAGAGTGGGCTGGGGGTTGCGGG - Intronic
902799098 1:18818419-18818441 GAGGGGGAGCTGAGGGAGGTGGG + Intergenic
903684368 1:25120146-25120168 GAGGGTGTGCTCAGGGATCCTGG - Intergenic
904041994 1:27590491-27590513 GGGTGTGTGCTGAGGGGTGGTGG - Intronic
904550020 1:31308048-31308070 GCATGTGAGGTGAGGGATACTGG + Intronic
906089975 1:43170819-43170841 GACTTTGAGCTGATGGAGGCGGG + Exonic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
906652214 1:47520937-47520959 AATTGGGGGCTGAGGGATGCTGG + Intergenic
906690677 1:47790965-47790987 CACTGTGAGCTAAGAGATGCTGG - Intronic
907222131 1:52914847-52914869 GTGGGTGATCCGAGGGATGCAGG - Intronic
907438440 1:54463979-54464001 GAGTGTGAGCTGTGGGACCGAGG - Intergenic
907510519 1:54954608-54954630 GAGTGTGAGGTGGGGGCTGCAGG + Intergenic
908355546 1:63322887-63322909 GAGTGTGAGCTGAGCCCAGCGGG + Intergenic
909169929 1:72282517-72282539 GAGTGCGAGCTGAAAGCTGCTGG - Exonic
909416329 1:75409966-75409988 AAATGTGAGCTGAGGAATCCTGG - Intronic
910930295 1:92436730-92436752 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
911541435 1:99162530-99162552 GAGGGTGAGCTGAAGCAGGCTGG - Intergenic
912032461 1:105265677-105265699 GAGGGTGAGCTGAAGGAAGGTGG - Intergenic
912516643 1:110220478-110220500 GAGGGTGAGCAGAGGGAGGGAGG - Intronic
912999101 1:114562076-114562098 GACCATGAGCTGAGGAATGCAGG - Intergenic
913531014 1:119734357-119734379 GCTTGAGAGCTGAGGGAAGCAGG - Intronic
914919789 1:151839097-151839119 GAGTCAGAGGTGAGTGATGCTGG + Exonic
915455099 1:156035338-156035360 GTGTGGGAGCTGGGGGAGGCAGG + Exonic
916000408 1:160609752-160609774 TAGTGTGAGGAGAGGTATGCAGG + Exonic
916100460 1:161389721-161389743 GAGTATGAGGTGAGGTATGCAGG + Intergenic
916251816 1:162746145-162746167 GAGTGTGAGCTGAAGCAGGGTGG + Intronic
916330793 1:163614294-163614316 AGGTGTGAGCTGAGAGATTCTGG + Intergenic
917530592 1:175831490-175831512 GAGAGTGGGCTGAGGGAAGATGG + Intergenic
917893786 1:179466086-179466108 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
922469434 1:225866829-225866851 CACTGTGGGCTGAGGGGTGCTGG - Intronic
922798090 1:228351442-228351464 GAGTGTGAGGTGAGGAGTGCAGG + Exonic
923068413 1:230540860-230540882 GAGTGAGAGCGTAGGGAAGCTGG + Intergenic
923529818 1:234804285-234804307 GAGAGTGGACTGAGGGATGAGGG - Intergenic
924256253 1:242185921-242185943 GAGTTTGTGCTGACAGATGCTGG - Intronic
1062963654 10:1591934-1591956 GTGGGTGAGGTGAAGGATGCCGG - Intronic
1063958180 10:11284489-11284511 GAGTGTGTGGTGGGGGATGAGGG + Intronic
1064048822 10:12042854-12042876 GAGGGGGAGCTGAGGGAAGGCGG - Intronic
1064145823 10:12825708-12825730 CAGTGTCAGCTGAGGGATTCTGG - Intronic
1066107019 10:32165248-32165270 GAGTGGGAGGAGAGGGAGGCTGG + Intergenic
1066162959 10:32754794-32754816 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
1067800266 10:49353786-49353808 GAGGGTGTGGGGAGGGATGCTGG - Intergenic
1067850784 10:49752388-49752410 GAGAGTGAGCCCAGGGAGGCAGG + Intronic
1069355944 10:67585031-67585053 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1069646352 10:70001342-70001364 GAGTGGGAGCTGAGGGAAGGGGG - Intergenic
1069799531 10:71073519-71073541 GAGTGAGGGCTAATGGATGCTGG + Intergenic
1069913432 10:71773280-71773302 GAGTGGGAACTGTGGGATGGGGG - Intronic
1070150818 10:73803806-73803828 AAGTCTGTGCTGAGGGAAGCTGG + Intronic
1070752333 10:78971732-78971754 GAGTATGACCTGAGGGGTGGAGG + Intergenic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1071531297 10:86391991-86392013 GAGAGGGAGCAGAGGGAAGCAGG + Intergenic
1071879778 10:89884042-89884064 GAGATAGAGCTGAGGGATGTTGG - Intergenic
1071922934 10:90371792-90371814 GAGGGTGAGCTGAAGCAGGCGGG - Intergenic
1072628729 10:97131269-97131291 GTGTGTGTGGTGAGAGATGCCGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1072822711 10:98574017-98574039 GGATGAGAGCTGAGGGATGCAGG - Intronic
1073605919 10:104895544-104895566 GAGTGTGAGCTGAGGGATGCTGG - Intronic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1074490938 10:113939039-113939061 GTGTGTGAGCTCAGGGATAGAGG - Intergenic
1074629829 10:115239940-115239962 GAGTGGGAGTTGAGGGATGAAGG + Intronic
1074860314 10:117505016-117505038 AATTTTGAGCTGAGGGCTGCTGG - Intergenic
1076307610 10:129476031-129476053 GAATGAGAGCCGAGGGAGGCAGG - Intronic
1076391463 10:130105893-130105915 GGGGGGGAGCTGGGGGATGCGGG - Intergenic
1076462025 10:130654338-130654360 AGGTGTGAGCTGAGGGCTGGGGG + Intergenic
1076728990 10:132429096-132429118 GAGGCTGAGCTGCTGGATGCAGG - Intergenic
1076810453 10:132883895-132883917 GAGTGAGTGCTGATGGATGCAGG + Intronic
1078458483 11:11494467-11494489 GAGTTTGAGCTGAGCTTTGCAGG - Intronic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1079062112 11:17258172-17258194 CAGTTTGAGCTGAGGTATGCAGG + Intronic
1079083870 11:17431628-17431650 GTGTGTGAGCTGAGCCATGGGGG - Intronic
1079089064 11:17468108-17468130 GAATGGGAGCTGGGGGAAGCAGG - Intronic
1080599276 11:33806871-33806893 AGGTGAGAGCTGAGGGATGCTGG + Intergenic
1080818231 11:35779410-35779432 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1080917350 11:36673564-36673586 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1081864718 11:46353227-46353249 CAGTGTGAGCTGGGGGATCCTGG - Intronic
1081869957 11:46378924-46378946 GCGTGTGAGCTCAGGGAAGGAGG + Intronic
1082182132 11:49132956-49132978 GAGTGTGGGCAGAGTGATGTAGG - Intergenic
1082838148 11:57666993-57667015 TTGGGTGAGGTGAGGGATGCGGG + Intergenic
1083028557 11:59571252-59571274 GCATGTGAGCTGAGAGTTGCAGG - Intergenic
1083319917 11:61839184-61839206 GAGGGCGAGCTGAGGCAGGCAGG - Intronic
1083706439 11:64519568-64519590 AGGTGTGAGCTGAGAGAGGCAGG + Intergenic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084582468 11:70032510-70032532 GAGAGTGAGCAGAGGGAGGCGGG + Intergenic
1085276956 11:75306642-75306664 GAGCCTGAGCTGGGGGCTGCAGG + Intronic
1086812073 11:91322271-91322293 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1087547148 11:99598691-99598713 CAGTGATAGCTGAGGGAAGCAGG + Intronic
1088562229 11:111126867-111126889 GATTGTAAGCTGGGGGAAGCGGG - Intergenic
1090359201 11:126160937-126160959 GCGGGTGAGATGAGGGATGCTGG - Intergenic
1090685934 11:129119666-129119688 GAGAGGGAGATGAGGAATGCTGG + Intronic
1090732261 11:129582042-129582064 AAGTGACAGCTGAAGGATGCAGG - Intergenic
1091072316 11:132579409-132579431 GTGTGTGTGATGAGGGAGGCTGG + Intronic
1091440286 12:507588-507610 GGGTGTGGGGTGAGGGATGTAGG - Intronic
1091747781 12:3003658-3003680 GGGTGTGAGCTGGGGGCTGTCGG + Intronic
1091829344 12:3538559-3538581 GAGTGACAGCTAAGGGGTGCTGG + Intronic
1092214426 12:6671019-6671041 CAGCTTGAGCTGAGTGATGCAGG - Intronic
1092232209 12:6782522-6782544 GGGTGTGAACTGAGGGAGACAGG + Intergenic
1092711313 12:11340388-11340410 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1093660664 12:21752995-21753017 GACTGTGAGATGAGGGATAGTGG + Intronic
1094384855 12:29883205-29883227 GACTGTGATTTGAGGGATTCTGG + Intergenic
1095488407 12:42708037-42708059 GAGGGTGAGCTGAGGCAGGGTGG + Intergenic
1095984936 12:47993089-47993111 GGGTGTGATCTGAGGCATCCTGG - Intronic
1096266779 12:50129873-50129895 GAGGGTGAGCTGAGGGCTGGAGG - Exonic
1096560815 12:52434467-52434489 GAGTGTGAGCTCAGGGTTGGCGG - Exonic
1099097866 12:78398130-78398152 GACTGTGGGCTGAGAGATGATGG - Intergenic
1099512687 12:83556526-83556548 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1100965698 12:100010900-100010922 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1101975245 12:109352352-109352374 GAGTGGGAGGTGAGAGATGAGGG - Intronic
1102030930 12:109739701-109739723 GACTGGGAGCTGAGGGCTGACGG + Intronic
1102296893 12:111744137-111744159 AATAGTGAGCTGAGTGATGCTGG + Intronic
1102392943 12:112564068-112564090 GAGTTTGGGCTGAGGAAGGCAGG - Intergenic
1103184531 12:118945088-118945110 GAGGGAGAGCTGAGGGTTGGGGG - Intergenic
1103427625 12:120850810-120850832 GAATGTGAGCCAAGGAATGCAGG - Intronic
1103437039 12:120934808-120934830 GAATGTGAGCCAAGGAATGCAGG + Intergenic
1103556649 12:121770650-121770672 GGGTGTGCTCTGAGGGTTGCTGG + Intronic
1104471424 12:129032889-129032911 CCTTGTGAGCAGAGGGATGCAGG - Intergenic
1104986765 12:132601570-132601592 GTGGGTGAGCTGAGGTTTGCAGG - Intergenic
1106143113 13:27027442-27027464 TAGTGGGAGCTGAGGGAGGGAGG + Intergenic
1107686333 13:42903430-42903452 GAGGGAGAGCTAATGGATGCTGG + Intronic
1108606006 13:52039255-52039277 GGGAGTGAGCTGAGGGATGAGGG + Intronic
1108676919 13:52745022-52745044 GAGTGTGAGGTGAGTGAGGGAGG + Intergenic
1108738869 13:53314107-53314129 GAGTGTGAGCTGAGGCCAGGAGG + Intergenic
1112285850 13:98103708-98103730 GACTGTGAGCTGGTGGATTCTGG - Intergenic
1113383871 13:109829344-109829366 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1113519304 13:110927700-110927722 GAGGAATAGCTGAGGGATGCTGG + Intergenic
1113583742 13:111448688-111448710 GAGTGTGAGCTGGGGCATCAGGG - Intergenic
1114559784 14:23581123-23581145 GAGTGCGGGCTGAGGAGTGCGGG + Intergenic
1114677563 14:24453874-24453896 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1115441689 14:33443088-33443110 CAGTGTTAACTGAGGGAAGCTGG - Intronic
1115737506 14:36349613-36349635 GGATGTGAGCTTAGGGCTGCTGG + Intergenic
1115752966 14:36508513-36508535 GACTGAGAGCTGGGGGGTGCGGG + Intronic
1117021633 14:51576606-51576628 GAACGTGAGCTTAGGGGTGCAGG - Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1117489136 14:56228775-56228797 GAGTGTGAGCTGAGGCAGGGTGG + Intronic
1118004977 14:61557559-61557581 GAGAGTGAACTGAGTGATGAAGG + Intronic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1119098209 14:71854116-71854138 GTGTCTGAGCTGGGGGATGAGGG + Intergenic
1119264398 14:73255460-73255482 GACTGTGTGCTGAGGGAAGGAGG + Intronic
1119478871 14:74947501-74947523 GAGTGTGGGAGGAGGGATTCTGG - Intronic
1121144895 14:91574813-91574835 GGGAGGGAGCTGAGGGATGTAGG + Intergenic
1121214052 14:92233405-92233427 GAGTGTGAGCTGAAGTACGGCGG - Intergenic
1122857160 14:104565471-104565493 GCGTGTGAGCTGCGGGAAGCAGG + Intronic
1123407384 15:20029374-20029396 GAGAGTGGACTGAGAGATGCCGG + Intergenic
1123516711 15:21036030-21036052 GAGAGTGGACTGAGAGATGCCGG + Intergenic
1124007023 15:25802643-25802665 GGCCGTGAGCTGAGGCATGCAGG - Intronic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1124614137 15:31229404-31229426 GGGTGTGAGCTGAGGTCTCCTGG - Intergenic
1126740004 15:51768119-51768141 GCGTGTGAGCTGAGGGCTGGGGG - Intronic
1128148281 15:65344823-65344845 GGCTGTGTGCTGTGGGATGCAGG + Intronic
1128453199 15:67819049-67819071 GAGAGTGAGCTGGGGCATGGTGG - Intergenic
1129175548 15:73837498-73837520 GAGTCTATGCTGAGGGAAGCTGG + Intergenic
1129913479 15:79247300-79247322 GAGTGTGTGCTCAGGGAAGGAGG - Intergenic
1131317385 15:91351929-91351951 GAGTGTGAGCAAGGGGAGGCTGG + Intergenic
1132116181 15:99138046-99138068 CAGGGTGTCCTGAGGGATGCTGG + Exonic
1132728750 16:1350343-1350365 GACTGTGAGCTGATGTTTGCTGG - Intronic
1133423999 16:5671846-5671868 CAGTGTGAGCTGGGGGTTGAAGG + Intergenic
1133623500 16:7548953-7548975 GAATGTGAGCTCTGGGATGGTGG - Intronic
1134108755 16:11501708-11501730 GAGTCTGGGCTGGGGGGTGCTGG - Intronic
1134186586 16:12089662-12089684 GAGAGTGAGTTGGAGGATGCTGG + Intronic
1134230244 16:12423409-12423431 GGCTCTGAGCTGAGTGATGCCGG - Intronic
1134354122 16:13465207-13465229 GAGTTTGGGCAGAGGGCTGCTGG - Intergenic
1135425883 16:22335695-22335717 GAGTGTGAGCTCATGGGTGCAGG - Intergenic
1135987869 16:27197398-27197420 GTGTGTGTGGTGAGGGCTGCTGG - Intergenic
1136476644 16:30517712-30517734 GCGTGTGAGCTGAGAGACGGTGG + Intronic
1136565772 16:31069306-31069328 GAGTGGGAGGTGAGGTAGGCAGG - Intronic
1137615090 16:49841655-49841677 AAGTGTGGGCTGAGGGCTGTGGG - Intronic
1138164970 16:54792780-54792802 GAGTGAGCTCTGAGGCATGCCGG + Intergenic
1139451256 16:67029477-67029499 GAGTGTGAGGTGAGGCAGGCGGG + Exonic
1140721690 16:77777840-77777862 AAATGTGAGCTCAGGGTTGCTGG - Intergenic
1141221119 16:82070178-82070200 GTGTCTGAGCTGTGGGATGCAGG - Intronic
1141321031 16:83008957-83008979 GAATGAGAGCTGAGTGAAGCGGG + Intronic
1141851656 16:86650246-86650268 GAGTGTGTTCTGGGGGATGAAGG + Intergenic
1142369594 16:89670918-89670940 TAGCCTGAGCTGAGGGTTGCTGG - Intronic
1142742772 17:1940708-1940730 GAGTGTGAGCTGAGAGAGACGGG - Intronic
1142749343 17:1978016-1978038 GAGTGAGAGATGCGGGGTGCAGG - Intronic
1143023946 17:3930151-3930173 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1143023977 17:3930243-3930265 GAGTGGGGGCTGAGGGCTGGGGG - Intronic
1146835667 17:36108652-36108674 GAGAGTGAGCTGGGGGAGGTGGG - Intergenic
1146850299 17:36215922-36215944 GAGAGTGAGCTGGGGGAGGTGGG - Intronic
1146956104 17:36937165-36937187 GAGCGTGGGCCGAGCGATGCGGG + Intronic
1147014863 17:37483522-37483544 GAGTGTGTGTTGAGGGGTGGGGG + Intergenic
1147233216 17:39034858-39034880 GAGTGTTACCTCAGGGATGAGGG - Intergenic
1148065941 17:44869823-44869845 TAGTGTGAGCTGAGTGCTGTAGG - Intronic
1148776620 17:50099293-50099315 CTGGGAGAGCTGAGGGATGCAGG + Intronic
1150219169 17:63486466-63486488 AAGTGGGAGCTGAGGGCTGGAGG - Intronic
1151653916 17:75486593-75486615 CAGTGAGAGCTGTGGGATGGTGG + Intronic
1151836414 17:76585578-76585600 GAGGTTGGGCTGAGGGCTGCGGG + Intronic
1151926729 17:77203028-77203050 GAGTGGGAATTGAGGGAAGCTGG + Intronic
1152370949 17:79888325-79888347 GAGAGTCAGCTGAGAGACGCTGG - Intergenic
1153402340 18:4694879-4694901 GAGTGTGAGCTGAGGCAGGGCGG + Intergenic
1154401622 18:14043552-14043574 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
1155145267 18:23078147-23078169 GGGAGGGAGCTGAGGGATGTGGG - Intergenic
1156164141 18:34397707-34397729 GAGTGAGAGCTGGGGGTTCCGGG - Intergenic
1157056775 18:44238702-44238724 GAGTGGGATCAGAGGAATGCTGG + Intergenic
1157336271 18:46739769-46739791 GAATGAGAGCTGAGGGCTGTCGG - Intronic
1160014677 18:75131612-75131634 GTGTTTGAGCTCCGGGATGCTGG - Intergenic
1160390494 18:78527699-78527721 GAGTGGGAGCTGTGGGGAGCAGG - Intergenic
1160397089 18:78580472-78580494 TAGTGTGATCTGAGAGGTGCTGG - Intergenic
1160534664 18:79585653-79585675 GAGTGTGGGGTGCGGGATGCTGG - Intergenic
1160534702 18:79585784-79585806 GAGTGTGGGGTGGGGGCTGCTGG - Intergenic
1160591479 18:79947297-79947319 GAGTGTGATCTGCTGAATGCTGG + Intronic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163910856 19:20191005-20191027 AAGTGTGAGGTGAAGGATCCAGG - Intronic
1164556319 19:29255462-29255484 GAGGGTGAGCTGAAGCATGCTGG - Intergenic
1164702473 19:30295629-30295651 GAGTGGGAGCTGGGGGCTCCAGG + Intronic
1165343319 19:35227607-35227629 GAGTGTGAGTTCTGGGAGGCAGG + Intronic
1165756013 19:38293405-38293427 GAGAGTGGGCTGAGGCATGCGGG - Intronic
1166208908 19:41292671-41292693 GAGTGTGAGGTGAGGGGTGTTGG + Intronic
1166838090 19:45679569-45679591 GAGTGTCCACTGAGGGATGGGGG + Intronic
1167026084 19:46919554-46919576 GAGTGTCAGCCGAAAGATGCAGG + Exonic
1167122191 19:47524219-47524241 GAATGTTAGCTGTTGGATGCTGG - Intronic
1167423168 19:49415522-49415544 AGTTGTGAGCTGAGGAATGCAGG + Intronic
1167528840 19:50002216-50002238 GACACTGAGCTGAGGGATGGGGG + Intronic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168585471 19:57588197-57588219 GAGTGTGAACTGAAGGACCCAGG + Intronic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925545322 2:5009538-5009560 ATGTTTGAGGTGAGGGATGCGGG - Intergenic
925986814 2:9223066-9223088 AAGTGTGACTTGAGAGATGCAGG - Intronic
927699807 2:25260785-25260807 GACTGAGAGGTGAAGGATGCGGG + Intronic
927889852 2:26741503-26741525 GAGTGTGAGCACAGGGCTGATGG + Intergenic
930032658 2:47068052-47068074 GAGAATGAGCTGAGGGACGAGGG + Intronic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
934557288 2:95294222-95294244 GAGAGAGAGCTGAGGGGTACAGG - Intergenic
934715853 2:96542835-96542857 ATGTGTGAGCTGAGGGTAGCAGG + Intronic
935845841 2:107164739-107164761 GAGTGTCAGCTCAGGGGTCCTGG + Intergenic
936339167 2:111616296-111616318 GTGTGTGAGATGAGAGAGGCTGG + Intergenic
936618923 2:114075061-114075083 TAGAGTTAGCTCAGGGATGCTGG - Intergenic
936859578 2:117001291-117001313 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
937629046 2:124078796-124078818 GAGTGTCTGGAGAGGGATGCAGG + Intronic
939137290 2:138312619-138312641 GGGTGTGAGCTGAGAGGAGCAGG + Intergenic
939153067 2:138495540-138495562 GACTGAGTGCTGAGAGATGCAGG + Intergenic
939744512 2:145952173-145952195 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940535876 2:154943671-154943693 GAGTTTGAAATGAGGGATGAGGG - Intergenic
940644478 2:156376226-156376248 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
940827823 2:158433650-158433672 AAGTGTGAGCTGAAGCATGGTGG + Intronic
940976212 2:159947895-159947917 GAGTGGCAGCTGACTGATGCTGG + Intronic
943220853 2:185104272-185104294 GAGTCTGTCCTGAGAGATGCTGG + Intergenic
944347292 2:198684600-198684622 GAGGGTGAGCTGAAGAAGGCTGG + Intergenic
944528150 2:200641338-200641360 AAGTGTGAGCCCAGAGATGCTGG + Intronic
944833311 2:203554642-203554664 GAGTAAGAGATGAGAGATGCAGG + Intergenic
944867845 2:203880006-203880028 GAGTTCAGGCTGAGGGATGCTGG + Intergenic
946391990 2:219421583-219421605 GAGTGGGAGGTGCGGGGTGCTGG + Intronic
947344441 2:229176321-229176343 GACTATGAGCTGAGGCAAGCAGG - Intronic
947812983 2:233015823-233015845 GAGAGTGAGCAGAAGGATGAGGG - Exonic
948851904 2:240712408-240712430 GAGTGTGGGCTGAGTGGCGCTGG - Intergenic
948991095 2:241554445-241554467 GAATGTGACCTGGAGGATGCTGG - Intergenic
949042837 2:241857478-241857500 GAGGGGGAGCTGAGCGAGGCAGG - Intronic
1169236064 20:3930866-3930888 AGGTCTGAGCTGAGGGATACAGG - Intronic
1170566858 20:17612468-17612490 GTGTGTGAGGTGAGGGAGGCTGG - Intergenic
1170589654 20:17762191-17762213 GAGGGTGAGGTGAGTGAGGCAGG + Intergenic
1171188570 20:23141775-23141797 GAGTGTGATCTGAGGGGAGGTGG + Intergenic
1171238294 20:23545621-23545643 GATTAGGAGCTGAGGGGTGCAGG + Intergenic
1171793940 20:29551876-29551898 GAGTGTGAGTTGGGGGAGGTTGG + Intergenic
1171854531 20:30332515-30332537 GAGTGTGAGTTGGGGGAGGTTGG - Intergenic
1172425017 20:34850111-34850133 GGGTGAGAGCTGAGGAATCCTGG - Intronic
1172456334 20:35077229-35077251 GAGTGTGAGCTGAAGCAGGGCGG - Intronic
1172613384 20:36267559-36267581 GTGTGGGAGCTGGGGGTTGCAGG + Intronic
1173003610 20:39123199-39123221 GAGTGTAAGGGGAGGGAGGCAGG + Intergenic
1173545491 20:43894685-43894707 GGGAGTGAGCTGAGGGAGGCTGG - Intergenic
1173908338 20:46645112-46645134 GGCTGTGAGCTGAGGAATGCAGG - Intronic
1175286457 20:57840036-57840058 GCTTGTGAGCTGAGGGAGGTGGG + Intergenic
1175985613 20:62762922-62762944 GGCTGTGAGCAGAGGGATCCCGG - Intergenic
1176188498 20:63795014-63795036 GAGTGGGTGCTGCGGGCTGCAGG + Intronic
1176972901 21:15287579-15287601 GAGTATGTGCTGTGGGATGGAGG - Intergenic
1180927872 22:19568546-19568568 GAGAGTGGGCTGGGGGATGGTGG + Intergenic
1181081902 22:20421253-20421275 GAGTGTGATGTGGGGGGTGCAGG + Intergenic
1182299733 22:29330848-29330870 GAGGGTGTGCTTAGGGAAGCAGG - Intronic
1182632723 22:31699499-31699521 GATTTTCAGATGAGGGATGCTGG + Intronic
1184046472 22:41975607-41975629 GAGAGTGAGATCAGGGAGGCAGG - Intergenic
1184109454 22:42386518-42386540 GAGTGTGAGCTGGTAGAAGCTGG - Intronic
1184755170 22:46511766-46511788 GAGGGTGAGATGAGGGAAGGAGG + Intronic
1185041285 22:48505733-48505755 GAGGGTGGTCTCAGGGATGCTGG - Intronic
1185164402 22:49251912-49251934 GAGTGTGAGCTGAGGGAAGGAGG + Intergenic
949491729 3:4595688-4595710 GAGTAGGAGCTGGGGGTTGCAGG + Intronic
949908567 3:8880386-8880408 GGGTGGGAGTTGGGGGATGCTGG + Exonic
951368256 3:21812372-21812394 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
952925914 3:38319073-38319095 GGGTGTGAGCTGGGGTATGGGGG - Intergenic
954291755 3:49653634-49653656 GAGGCTGAGCTGGGGGAGGCAGG - Exonic
954683570 3:52358771-52358793 GAGAGGGAGCAGAGGGGTGCAGG - Intronic
954744593 3:52779944-52779966 GTGGCTGAGTTGAGGGATGCAGG + Intronic
954805572 3:53218092-53218114 GAGAGTGAGCTGTGGGGGGCTGG - Intergenic
957904685 3:86540821-86540843 GAGTTTGAGATGAGGGGTGCAGG + Intergenic
961817751 3:129560004-129560026 GAGTATGGGCTGTGGGGTGCCGG + Intronic
963306816 3:143662475-143662497 GAGTGTGAGCTGAAGCAGGGCGG + Intronic
963732010 3:148984221-148984243 GTGTGGGAGCTGGGGGAGGCAGG + Intergenic
966049047 3:175590901-175590923 GTGTGTGTGCTTAGGGATGAAGG + Intronic
966248066 3:177830972-177830994 GAGTTTGAGGTGAGGGATGGCGG + Intergenic
967237894 3:187405513-187405535 GAGTGTTATTTGGGGGATGCAGG - Intergenic
968376078 4:42519-42541 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
968447650 4:660434-660456 GATTGTGGGCTGAGGGAGGTTGG - Intronic
969115389 4:4867644-4867666 GGCTGTGAGCTGAGGGCCGCGGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
972169752 4:36331607-36331629 GAGTGTGAGGTTAGGGCAGCTGG + Intronic
972973371 4:44604546-44604568 GAATGAGATATGAGGGATGCCGG - Intergenic
973348361 4:49081645-49081667 GAGTGTGCCCTGAGGGAGGTAGG + Intergenic
973626118 4:52774128-52774150 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
973638260 4:52879587-52879609 AAGTGTGGGCTGAAGGCTGCTGG - Intronic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
975156489 4:71078651-71078673 GAGTATGAGCTGAGCGAAGAAGG - Intergenic
975305828 4:72847809-72847831 GAGTGTGAGCTGAAGCAGGGAGG + Intergenic
976366044 4:84233297-84233319 GAGTTTGAGCTGAGACATGAAGG - Intergenic
977100573 4:92808138-92808160 GGGTGTAAGCTGAGGTATGCGGG + Intronic
977436803 4:97007530-97007552 GTGTGAGAGCTGGGTGATGCTGG + Intergenic
978110780 4:104961745-104961767 GAGTGTGAGCTGAAGCAGGGTGG - Intergenic
982047284 4:151461376-151461398 AAGTGTGAGGTGAGGTATGGTGG + Intronic
982184094 4:152779321-152779343 AAGTAAGAGCTCAGGGATGCCGG + Intronic
982187062 4:152813304-152813326 GAGTGTGGGCTGGGGGGTCCTGG + Intronic
982316867 4:154040845-154040867 GACGGTGAGCTGGGGGATGTGGG + Intergenic
983632212 4:169860594-169860616 GAGTGTGAGCTCCTGGATGAGGG - Intergenic
984138308 4:175969805-175969827 AAGTGTGTGTGGAGGGATGCAGG + Intronic
984713140 4:182902732-182902754 GTGTGTGGGCTGCGGGATGGAGG + Intronic
985655830 5:1130955-1130977 GAGGGTGGTCTGAGGGCTGCTGG + Intergenic
985805459 5:2039593-2039615 AATTGTGGGCTGAGGCATGCCGG - Intergenic
986503913 5:8429896-8429918 GAGTGGGGGCTGAGGGAGGCTGG - Intergenic
986662887 5:10074860-10074882 GAATGGGAGGTGAGGGAGGCAGG + Intergenic
988714911 5:33815884-33815906 GTATGTGAACTGATGGATGCTGG - Intronic
989418198 5:41205397-41205419 GAGTGTGAGCTGAAGAAGGGCGG + Intronic
990257410 5:53985219-53985241 GAGTGTGAGCAGAGGGAGTGAGG - Intronic
990319163 5:54612855-54612877 GAGGGTGGGTTGAGTGATGCTGG - Intergenic
991017103 5:61944016-61944038 GACTGTGTGCCCAGGGATGCTGG - Intergenic
992484170 5:77179986-77180008 GATTGTGAGTTGAGGGCTGCAGG + Intergenic
993546568 5:89220051-89220073 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
993742209 5:91555534-91555556 GAGTGTGAGCTGAAGGAGGGCGG + Intergenic
993826774 5:92697892-92697914 CAATGTGAGCTGAGGGAAGGAGG + Intergenic
993888243 5:93442217-93442239 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
996357519 5:122613074-122613096 GAGGGGGAGCTGAGGGCTACAGG - Intergenic
996803897 5:127433378-127433400 GCGTGTGTGCTGAGGGACGCTGG + Exonic
998266734 5:140672618-140672640 AAGTGTGAGCTGAGCGTTGACGG - Exonic
1000138768 5:158381085-158381107 GCATCTGAGCTGAGGCATGCAGG - Intergenic
1000243949 5:159433563-159433585 GAGTGTGACCTTAGGGAAGAAGG + Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001771683 5:174301719-174301741 GAGAGTTAGCCGAGGGGTGCAGG - Intergenic
1002345154 5:178543661-178543683 GAGGAGGAGCTGAGAGATGCAGG - Intronic
1003269085 6:4591540-4591562 TAGAGTGAGTTGAGGGCTGCGGG - Intergenic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1006050137 6:31335920-31335942 GAGTGGGAGGTGGGGGATGTTGG + Intronic
1006739540 6:36297523-36297545 GAATGTGAGCTGAGGAATGGAGG - Intronic
1006986020 6:38176136-38176158 ATGTGTGAGCTGTGGGGTGCAGG + Intronic
1006990005 6:38207185-38207207 GACTATGAGCTGGGGGATGGGGG + Intronic
1007363773 6:41375835-41375857 GGGTGTGAGATGAGGGAAGTTGG + Intergenic
1007398434 6:41590173-41590195 GAGGGTGGGCTGGGGGCTGCAGG + Intronic
1007850218 6:44795503-44795525 GGCTGTGGGCTGCGGGATGCGGG - Intergenic
1008652893 6:53581281-53581303 GAGTGAGTGCTCAGGGAAGCTGG + Intronic
1009988155 6:70806476-70806498 GAGGGTGAGCTGAAGGAGGGCGG - Intronic
1013587165 6:111589700-111589722 GAGTGTGAGATCAGGAATGAGGG - Intronic
1013843537 6:114424914-114424936 GAGGCTGGGATGAGGGATGCAGG + Intergenic
1014347072 6:120285213-120285235 CATTGTAAGCTGAGGTATGCTGG - Intergenic
1014827710 6:126065330-126065352 GAGTGGGAGCTGAGTCCTGCAGG + Intergenic
1015552776 6:134429920-134429942 GAGTGAGAGCTGGGGGCTGGAGG - Intergenic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1017984329 6:159429901-159429923 GAGTGTGACCAGAGGGAAGTTGG - Intergenic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018175837 6:161178595-161178617 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1018220944 6:161578982-161579004 ATTTGTGATCTGAGGGATGCTGG - Intronic
1018573472 6:165234107-165234129 TAGACTGAGCAGAGGGATGCTGG - Intergenic
1018652492 6:166003730-166003752 GGCTGTGAGCAGAGGAATGCAGG + Intergenic
1018788769 6:167130287-167130309 GAGTGGCAGATGAGAGATGCAGG - Intronic
1018901157 6:168052420-168052442 GAGTGTGCCCTGTGGGGTGCGGG - Intergenic
1019071976 6:169354150-169354172 GAGGGTGAGCTGAAGGAGGGTGG - Intergenic
1019275219 7:172593-172615 GGGAGTGAGGAGAGGGATGCGGG + Intergenic
1019289879 7:245250-245272 GAGTGGGAGGTGTGGGCTGCAGG + Intronic
1019479416 7:1259749-1259771 GAGTGTGAGCAGAGGGAGGGTGG + Intergenic
1019716342 7:2541169-2541191 GGGTGGGGGCTGAGGGGTGCAGG - Intronic
1020211054 7:6158551-6158573 GAGAGAGAGCTGGGGGTTGCGGG + Intronic
1020898219 7:13969881-13969903 GACTGTGAGTTGTGGGTTGCAGG + Intronic
1022088315 7:27090076-27090098 GAGTGAGAGATTAGGGATGTGGG + Intergenic
1022808125 7:33843460-33843482 GTGTGTGAGCTGAGTGAGGCTGG + Intergenic
1023820882 7:43979902-43979924 GAGAGGCAGCTGAGGGTTGCCGG + Intergenic
1023878798 7:44307139-44307161 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878803 7:44307159-44307181 GGGTGTGAGCAGAGGGAGGAGGG + Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024757451 7:52552291-52552313 GAGTGAGAGCTGAGCGAAGAGGG - Intergenic
1024857824 7:53801866-53801888 GACTGTGGCCTGCGGGATGCAGG - Intergenic
1024907088 7:54397988-54398010 GGATGTGGGCTGAGGGATGCAGG - Intergenic
1026148907 7:67771711-67771733 GAGTGAGAACTGAGGGATCCAGG - Intergenic
1026648651 7:72195116-72195138 GAGTCTGAGCTGATGCATGAAGG - Intronic
1028243054 7:88444338-88444360 GAATGTGATCTGGGGGATGGTGG + Intergenic
1028244384 7:88459409-88459431 TGGTGTGAGATGAGGGAGGCAGG - Intergenic
1028630086 7:92925197-92925219 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1028909754 7:96194906-96194928 GAGTTTCAGCTGAGGCAGGCTGG - Intronic
1029129221 7:98317584-98317606 CGGTGTGAACTGAGGGATGAGGG - Intronic
1029749156 7:102533339-102533361 GAGAGGCAGCTGAGGGTTGCCGG + Intergenic
1029767099 7:102632443-102632465 GAGAGGCAGCTGAGGGTTGCCGG + Intronic
1029857560 7:103533099-103533121 GAGTGTCAGCTGAGGTTGGCTGG - Intronic
1030496569 7:110308018-110308040 GAGTGTGTGAGGAGGGAGGCTGG + Intergenic
1033881867 7:145894292-145894314 GAGCCTGAGCTCAGGGGTGCAGG - Intergenic
1034458175 7:151182978-151183000 GGGTGTGATCTCAGGGAGGCTGG + Intronic
1035112018 7:156491146-156491168 GAGGGGGAGTTGGGGGATGCGGG + Intergenic
1035442016 7:158909937-158909959 GAGTGTGAGGTGAAGGATCGGGG + Intronic
1035558876 8:590031-590053 GAGTGTGAGCTGAAGAAGGGCGG - Intergenic
1036481893 8:9147385-9147407 GGGTGTGAACTGAGGGAGGAAGG + Intronic
1036655304 8:10673864-10673886 GAGTGTGATATGGGGGTTGCAGG - Intronic
1038422199 8:27440451-27440473 GAGTGTGGGCTGTGGGCTGGGGG + Intronic
1038439914 8:27564557-27564579 GTGTGTGAGCTGAGGACAGCTGG + Intergenic
1038770415 8:30473870-30473892 AAGTGGGAGCTGAAGGATGAGGG + Intronic
1041318911 8:56593712-56593734 GAGTGTGGGCTGGAGGAGGCAGG + Intergenic
1041449373 8:57991189-57991211 GAGTCTGATCTGAGGGCTGAGGG + Intergenic
1041911265 8:63090996-63091018 GAGAGTGAGCTGATTGATGTTGG - Intergenic
1041997661 8:64083819-64083841 GAGTGTGAGCTGAAGCAGGGCGG + Intergenic
1042188871 8:66165339-66165361 GACTGAGAGGTGAGAGATGCAGG + Intronic
1043048818 8:75359823-75359845 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1043469157 8:80544835-80544857 GAAAGTGAGCAGAGGGAAGCTGG + Intergenic
1044971849 8:97627653-97627675 GGGTGTGAGCTGAGGAGGGCAGG - Intergenic
1045327546 8:101127799-101127821 GTGTGGGAGCAGAGGGATGGGGG + Intergenic
1046886679 8:119375256-119375278 GCCTATGAGCTGAGGAATGCTGG + Intergenic
1047179436 8:122573197-122573219 GTGAGTGAGGTGAGGCATGCAGG - Intergenic
1047205914 8:122802928-122802950 GAGTGGGGGCAGTGGGATGCAGG - Intronic
1048115486 8:131517197-131517219 GAGGGTAAGCAGAAGGATGCAGG - Intergenic
1048332463 8:133480041-133480063 AAGTGTGCGGTGAGGGAGGCCGG + Intronic
1048360180 8:133690844-133690866 AAGTGAGAGTTGAGGGGTGCTGG + Intergenic
1048871938 8:138806392-138806414 GGGTGTGAGATGAGGGAGGGAGG + Intronic
1049545074 8:143226785-143226807 AACTGTGAGCTGATGGGTGCAGG - Intergenic
1050012419 9:1198736-1198758 AAGTTTTAGGTGAGGGATGCAGG - Intergenic
1051535688 9:18154969-18154991 GAGTGTATGGTGAGGGTTGCTGG + Intergenic
1053284480 9:36841486-36841508 GAGTGTGAGCTCAGGGCAGGGGG - Intronic
1053792349 9:41695795-41695817 GAGTGTGAGTTGGGGGAGGTTGG - Intergenic
1054152813 9:61618968-61618990 GAGTGTGAGTTGGGGGAGGTTGG + Intergenic
1054180758 9:61907815-61907837 GAGTGTGAGTTGGGGGAGGTTGG - Intergenic
1054472599 9:65550173-65550195 GAGTGTGAGTTGGGGGAGGTTGG + Intergenic
1054656833 9:67673327-67673349 GAGTGTGAGTTGGGGGAGGTTGG + Intergenic
1054887304 9:70212592-70212614 GAGTGTGAGCTGAAGCAGGGTGG - Intronic
1054888491 9:70225402-70225424 GTGTGGGTGCTGGGGGATGCTGG + Intronic
1054986068 9:71262812-71262834 GAGAGTGAGCTGAAGCAGGCTGG - Intronic
1056078112 9:83062410-83062432 GAGTGTGAGCTGGGGGCGGGAGG - Intronic
1056131368 9:83590223-83590245 GGGTGTGAGGTGATGTATGCTGG - Intergenic
1056306993 9:85300193-85300215 GAGTGTGGGCTGAGGGTAGGAGG + Intergenic
1056667047 9:88589371-88589393 CAGTGTGAGCGGAGGGGTGGGGG + Intergenic
1057164828 9:92917257-92917279 GAGTGTGGGATGAAGGAAGCAGG + Intergenic
1057371536 9:94479033-94479055 AAGCGTGAGCTGCGGTATGCTGG - Intergenic
1057841394 9:98488066-98488088 GGATGCCAGCTGAGGGATGCAGG + Intronic
1058324386 9:103677494-103677516 GATTATGAGCTAAGGAATGCAGG - Intergenic
1059438904 9:114291792-114291814 GAGTGTGAGCTGAGGTTTGAAGG + Intronic
1059737786 9:117119513-117119535 GAGTGAAAGCTGTGAGATGCAGG - Intronic
1060104706 9:120866338-120866360 GAGAGTGAGCTGAGCTAGGCTGG + Intronic
1060284022 9:122233023-122233045 TAATGTGAGCTGGGGGAGGCTGG + Intergenic
1060437199 9:123604136-123604158 GAGCATGAGCTGAGGTAAGCAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060597475 9:124856930-124856952 GAGTGAGTGCTGAGGGCTCCTGG - Intronic
1061045010 9:128160221-128160243 GAGCGGGAGCTGCGGGATTCCGG + Intergenic
1061442665 9:130617051-130617073 GAGTCTCAGATGAGGGATTCTGG - Intronic
1061552430 9:131345363-131345385 GAGTGTGAGCTGAAGCAGGGCGG - Intergenic
1062201378 9:135304567-135304589 GAGGGTGAGTGGAGGGATGGAGG + Intergenic
1203573148 Un_KI270744v1:151631-151653 GAGTGTGAGCTGAAGCAGGGTGG + Intergenic
1185602527 X:1350123-1350145 GAGTGAGAGCTGAGAGAGGTGGG + Intronic
1187122342 X:16421626-16421648 GGGTGTGTGTTCAGGGATGCAGG - Intergenic
1187362270 X:18640015-18640037 GAGTGTTGGCTGATGGGTGCAGG + Exonic
1190286341 X:48963876-48963898 GAGAGTGAGCTGGGGGAGACTGG - Intronic
1190454760 X:50616860-50616882 GTGTGTGTGGTGAGGGATGGGGG - Intronic
1191034251 X:56007828-56007850 GATTCTTAGCTAAGGGATGCTGG + Intergenic
1194365382 X:93007570-93007592 GAGTGAGAGCTGAGTGAAGGAGG + Intergenic
1195036554 X:100975379-100975401 GAGTGGGAGCTGAGGAAGGAGGG - Intronic
1196932489 X:120695721-120695743 GAGTCTGAGCTGAAGGCTGAAGG + Intergenic
1197004166 X:121475185-121475207 GAGGGTGAGCTGAAGCATGGTGG - Intergenic
1197169949 X:123421708-123421730 CAGTGGGAGCTGAGGGAAGGTGG - Intronic
1198801010 X:140447762-140447784 GGGTGTGAGGTGGGGGATGAGGG - Intergenic
1200066024 X:153504452-153504474 GAGTGTGGGCAGAGGGCTCCAGG - Intronic
1200213688 X:154358129-154358151 GAGTGTGGGCTGCGGGTGGCTGG - Intronic
1200345150 X:155440378-155440400 GAATGAGAGCTGAGTGAAGCAGG + Intergenic
1201393147 Y:13520269-13520291 GAGTGTGAGCTGAAGCAGGCAGG - Intergenic
1201776194 Y:17668552-17668574 GAGTGTGAGCTGAAGAAGGGTGG - Intergenic
1201825362 Y:18237440-18237462 GAGTGTGAGCTGAAGAAGGGTGG + Intergenic
1201937291 Y:19422241-19422263 GAGGCTGAGATGAGGGGTGCAGG - Intergenic