ID: 1073608627

View in Genome Browser
Species Human (GRCh38)
Location 10:104921232-104921254
Sequence CTGCTGTGCTTTGTAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073608624_1073608627 8 Left 1073608624 10:104921201-104921223 CCATGCAGAATGGCAAGTGCCAA 0: 1
1: 0
2: 2
3: 14
4: 185
Right 1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG No data
1073608622_1073608627 16 Left 1073608622 10:104921193-104921215 CCTCAGGCCCATGCAGAATGGCA 0: 1
1: 0
2: 0
3: 18
4: 199
Right 1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG No data
1073608623_1073608627 9 Left 1073608623 10:104921200-104921222 CCCATGCAGAATGGCAAGTGCCA 0: 1
1: 0
2: 1
3: 7
4: 129
Right 1073608627 10:104921232-104921254 CTGCTGTGCTTTGTAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073608627 Original CRISPR CTGCTGTGCTTTGTAAAAAC AGG Intronic
No off target data available for this crispr