ID: 1073624410

View in Genome Browser
Species Human (GRCh38)
Location 10:105082094-105082116
Sequence GACACAATGCTTGACCTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073624410_1073624413 -4 Left 1073624410 10:105082094-105082116 CCTGTGAGGTCAAGCATTGTGTC No data
Right 1073624413 10:105082113-105082135 TGTCTAATAAGGAGGAATAAAGG No data
1073624410_1073624414 30 Left 1073624410 10:105082094-105082116 CCTGTGAGGTCAAGCATTGTGTC No data
Right 1073624414 10:105082147-105082169 CAGTACAAAGATTTCTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073624410 Original CRISPR GACACAATGCTTGACCTCAC AGG (reversed) Intronic
No off target data available for this crispr