ID: 1073627142

View in Genome Browser
Species Human (GRCh38)
Location 10:105110905-105110927
Sequence TAGCCCTGTGACTGGCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073627142_1073627148 20 Left 1073627142 10:105110905-105110927 CCCACCAGCCAGTCACAGGGCTA 0: 1
1: 0
2: 3
3: 17
4: 152
Right 1073627148 10:105110948-105110970 GTGGCAGCTCATCACCTATAGGG No data
1073627142_1073627146 1 Left 1073627142 10:105110905-105110927 CCCACCAGCCAGTCACAGGGCTA 0: 1
1: 0
2: 3
3: 17
4: 152
Right 1073627146 10:105110929-105110951 ATCAATATTTCTACATTCAGTGG No data
1073627142_1073627147 19 Left 1073627142 10:105110905-105110927 CCCACCAGCCAGTCACAGGGCTA 0: 1
1: 0
2: 3
3: 17
4: 152
Right 1073627147 10:105110947-105110969 AGTGGCAGCTCATCACCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073627142 Original CRISPR TAGCCCTGTGACTGGCTGGT GGG (reversed) Intronic
900402503 1:2478299-2478321 TTGCCCTGTCACTGGCAGGGCGG + Intronic
902532354 1:17098668-17098690 AAGCCCTGTGAGAGGCTGGGAGG - Intronic
903067902 1:20711053-20711075 TTGTTCTGTGACTTGCTGGTTGG + Intronic
905655138 1:39682152-39682174 TGGCCCTGTGACAGGCCTGTGGG + Exonic
905938102 1:41840740-41840762 TCGTCCAGTGACTGGCTGGCTGG - Intronic
906067842 1:42994942-42994964 AAGACTTCTGACTGGCTGGTTGG + Intergenic
906157039 1:43619901-43619923 TAGGCCTGTGCCTGGCTGGTGGG + Intronic
907094610 1:51766410-51766432 TAGCACAGTGCCTGGCTGATAGG - Intronic
908172428 1:61519143-61519165 TAGCCTTATGCCTTGCTGGTAGG - Intergenic
908740852 1:67326007-67326029 TAGCACTGTGCTTGGCTCGTGGG + Intronic
909769387 1:79401480-79401502 AAGCCCTGATACTGGCTGTTTGG - Intergenic
912250823 1:108010939-108010961 TAGCTGTGGGACTGGCTGGCAGG + Intergenic
912593842 1:110854220-110854242 TATCTCTGTGGCTGGCTGGCTGG + Intergenic
913521368 1:119648183-119648205 TGGCCCGCTGGCTGGCTGGTTGG + Intergenic
915745911 1:158157703-158157725 TAGCCCTGAGAGCTGCTGGTTGG + Intergenic
916426848 1:164688962-164688984 AAGACCTGTGTCTGGCTGGAGGG + Intronic
916487449 1:165272196-165272218 AAGCCCTGGGCCTGGCTGGTGGG - Intronic
920068987 1:203289188-203289210 TAGCTCTGCCACTTGCTGGTAGG - Intergenic
920514025 1:206571043-206571065 CAGCCCTGTGCATTGCTGGTGGG - Intronic
923020693 1:230161126-230161148 CAGTCCTGTGACTGTCTGGGCGG + Intronic
924537097 1:244944919-244944941 AAACCCTGTGAATGGCTGGCGGG + Intergenic
1063629962 10:7724197-7724219 TTGCCCTATGACTGGTTAGTTGG - Intronic
1064124763 10:12650345-12650367 TAGCCCTGTGTCTGGCTCTCTGG + Intronic
1064479935 10:15729501-15729523 GAGCTCTGTGACTAGCTGGCAGG + Intergenic
1067283788 10:44892830-44892852 GAGCCCTGTGCATTGCTGGTGGG - Intergenic
1067828229 10:49594964-49594986 TAGCCCTGTGCTTGGCTGCAGGG - Intergenic
1069568791 10:69481620-69481642 CAGCCCTGTGAGTGGCTGGAGGG + Intronic
1071513767 10:86283394-86283416 TAGCCCACTGCCTGGCTGGAAGG + Intronic
1073003150 10:100300224-100300246 TAGCCATGGGAGTGGCAGGTAGG + Intronic
1073627142 10:105110905-105110927 TAGCCCTGTGACTGGCTGGTGGG - Intronic
1074164674 10:110864585-110864607 TAGCCCAGTGATTTACTGGTTGG - Intergenic
1074546586 10:114405652-114405674 TAGCGCCGTGCCTGGCTTGTGGG - Intergenic
1075973021 10:126671238-126671260 TAACCCTGTGAGTGGCAGATGGG - Intergenic
1076755032 10:132564984-132565006 CAGCGCTGTGAATGGCTTGTTGG - Intronic
1077182169 11:1221656-1221678 GAGCCCTGTGCCCTGCTGGTGGG - Intergenic
1083813737 11:65120143-65120165 TACCTCTGTGACTGCCTGGCCGG - Intergenic
1083923108 11:65790985-65791007 TGGGCCTGTGCCTGGCTGGGTGG + Intronic
1084653505 11:70502357-70502379 TGGCCCTGTGGCTGGCAGGTGGG + Intronic
1085346148 11:75769164-75769186 GGGCCCTGTGGCAGGCTGGTGGG + Intronic
1085521906 11:77144048-77144070 TAGCTGTGTGACTGGCTGTGTGG - Intronic
1086615486 11:88813254-88813276 TATCCCTGTGACTTGCAGGTAGG + Intronic
1087394697 11:97583147-97583169 TTGTACTGTTACTGGCTGGTGGG + Intergenic
1095616280 12:44193435-44193457 TAGGACTGTGACTGGCTTGAGGG + Intronic
1104607385 12:130200011-130200033 TAGGCCTGTGCCTGGCAGGGAGG - Intergenic
1104999492 12:132680534-132680556 TAGCTCTGTGACTGTCAGGGAGG - Intronic
1111877267 13:93912859-93912881 TAACCCAGTCACTGGCAGGTAGG - Intronic
1113906005 13:113819513-113819535 CAGCTCTGGGACTGACTGGTGGG + Intergenic
1114493399 14:23117299-23117321 TTGCACTGTGACTGGGTGTTGGG - Exonic
1119728649 14:76937474-76937496 TAACACGCTGACTGGCTGGTGGG - Intergenic
1119854350 14:77888130-77888152 TAGCACTGTGCCTGGATGGATGG + Intronic
1120022299 14:79544481-79544503 TGGCCATGTGACTTGCTGGATGG + Intronic
1121530785 14:94651711-94651733 TGGCCCTGTGCCTGGGGGGTGGG + Intergenic
1122505850 14:102231284-102231306 GAGACCTGTCACTGGCTGGGTGG + Intronic
1123629462 15:22251120-22251142 TAGCTCTGTCCCTGGCTGGCGGG + Intergenic
1125969220 15:43898612-43898634 TAGCCCTGAGACTGGTGGTTTGG - Intronic
1127518796 15:59722599-59722621 TACCCCTGTGACTGATTGGAGGG + Intergenic
1130551758 15:84893850-84893872 AAGCCCTGTGACTGGCTTCCTGG - Intronic
1130750365 15:86705122-86705144 GGGCCCTGTCAGTGGCTGGTGGG + Intronic
1131100085 15:89681285-89681307 TAGCCCTGTCAATCGCTGGCTGG - Intronic
1131356880 15:91753020-91753042 TAGCACTGTGATTGGCAGGAGGG - Intergenic
1134020196 16:10916164-10916186 TTGCCCTCTGGCTGCCTGGTTGG + Intronic
1134880394 16:17740899-17740921 TAGCTCTGTCACTAGCTGGTTGG - Intergenic
1144487410 17:15678519-15678541 TCCCCTTCTGACTGGCTGGTAGG + Intronic
1144913623 17:18703796-18703818 TCCCCTTCTGACTGGCTGGTAGG - Intronic
1145066451 17:19764776-19764798 TAGAACTGTGACTGGCAGGCAGG + Intergenic
1146528452 17:33586955-33586977 TAGCACTGTGGCTGGCATGTAGG + Intronic
1147951912 17:44112257-44112279 CAGGCCTGAGGCTGGCTGGTGGG - Intronic
1148199979 17:45743785-45743807 GAGCCCTGTGCCTGGCTGGCAGG - Intergenic
1151404491 17:73877829-73877851 GAGCCCTGGGAGTGGCTTGTGGG - Intergenic
1151435022 17:74089852-74089874 CAGCCCTGCGACTGGCTGGGAGG + Intergenic
1151624948 17:75270837-75270859 TCTCCCTGGGACAGGCTGGTCGG + Intronic
1152220662 17:79063432-79063454 TGGCCCTGTGACTGGATGGAGGG - Intergenic
1152476034 17:80518772-80518794 TAGCCCTGGGACTGGTTAATAGG - Intergenic
1153013843 18:565568-565590 GAGCCCTGTGAAGGGCTGCTGGG - Intergenic
1158391524 18:57049057-57049079 CAGCCCTGCGGCTGGCGGGTGGG - Intergenic
1158663780 18:59414078-59414100 TAGCTCTGTAATTTGCTGGTGGG - Intergenic
1158945176 18:62441814-62441836 AAGTCTTGTGACTGCCTGGTAGG + Intergenic
1161007677 19:1944622-1944644 CCGCCCTGTGACTGGCACGTGGG + Intronic
1161284075 19:3459840-3459862 TGGCCCAGTGGCTGCCTGGTTGG + Intronic
1161635635 19:5387155-5387177 TGGCCCTGTGCCTGGCTGCTCGG + Intergenic
1167254416 19:48418697-48418719 TGGGCCTGTGACTGGGTGGATGG + Intronic
1168510591 19:56970590-56970612 GAACCCTGTGCCTGGCAGGTGGG + Intergenic
925031840 2:655819-655841 TGCCCTTGTGACTAGCTGGTTGG - Intergenic
925991302 2:9257061-9257083 ACGCCCTGTGACAGGCTGTTAGG - Intronic
927863061 2:26572477-26572499 TACCCCTGTGACCGCCTGGCTGG + Intronic
929530673 2:42749802-42749824 TATCACTGTTACTGGCTGGAGGG + Intronic
929881306 2:45839531-45839553 TAACCCTGGGAATGGCTGGGAGG + Intronic
931665427 2:64606934-64606956 TCTCCCATTGACTGGCTGGTGGG + Intergenic
932336255 2:70932958-70932980 TGCCCCTGTGGCTGGCAGGTAGG - Exonic
932977785 2:76625113-76625135 GAGCCCTGGGAGGGGCTGGTGGG + Intergenic
933211579 2:79575990-79576012 TAGCCCAGTGACTGGCTCTTAGG + Intronic
934862027 2:97772200-97772222 TGGCCATTTGGCTGGCTGGTTGG - Intronic
943559211 2:189441362-189441384 TAGGCCTGAGACTCGGTGGTAGG - Intergenic
947380205 2:229537825-229537847 TATACATGTGACAGGCTGGTGGG + Intronic
948328932 2:237150140-237150162 GAGTCCTGTGACTGGCTGGGAGG + Intergenic
948470894 2:238177929-238177951 AACCCCTGTGCATGGCTGGTGGG - Intronic
948913303 2:241017225-241017247 TTGCCCTGTTACTGGTTGATGGG + Intronic
948958066 2:241309843-241309865 TAGCCCTTTGCCTGGCTGAGTGG - Intronic
1170588652 20:17754535-17754557 TAGCACTGTGCCTGGCACGTAGG - Intergenic
1172119074 20:32587115-32587137 ATGCCCTGTGCCTGGGTGGTGGG + Intronic
1172692138 20:36797296-36797318 TAGCCCAGTCCCTGGGTGGTTGG + Intronic
1173418139 20:42876810-42876832 TAGGCCTGTGAGTGGCTGCAGGG - Intronic
1175538502 20:59732813-59732835 TAGCACAGTGCCTGGCAGGTGGG - Intronic
1178998046 21:37425206-37425228 GTGCCCTGTGACTGTCTGGCAGG + Intronic
1179626539 21:42652675-42652697 TGGCCCTGGCACTGGCTGGCCGG + Intergenic
1180009358 21:45039847-45039869 CAGCCCTAGGACTGGCGGGTGGG + Intergenic
1183979484 22:41531249-41531271 AAGCCTTGTGACAGGCTGATGGG + Intronic
1184653888 22:45931716-45931738 CAGCCCTGAGAGTGACTGGTGGG + Intronic
1184817240 22:46881587-46881609 TTGCCCAGTGTCTGGCTCGTAGG + Intronic
949575261 3:5332742-5332764 TTTCACTGTGGCTGGCTGGTTGG + Intergenic
949893648 3:8752954-8752976 CAGCCCTGGCCCTGGCTGGTGGG + Exonic
954138397 3:48592831-48592853 TGGCCCTGTGACTGGCTACAAGG - Exonic
955780299 3:62477512-62477534 TAGCCCTGTGCCTGGCATATGGG + Intronic
956874104 3:73445013-73445035 GAGGCCTGTGACTGGCGTGTAGG + Intronic
960010110 3:112824727-112824749 TAGCCCTGTAATTGACTGCTTGG - Intronic
960974872 3:123163907-123163929 AAGCCCTGTGCCTCGCAGGTGGG - Intronic
961620570 3:128220842-128220864 TATCCCTGTGGCTGGGCGGTGGG + Intronic
963081672 3:141400929-141400951 TTTCCCTGTGACTGGAAGGTGGG - Intronic
967138828 3:186535833-186535855 TAGCCCTTTGACTGGAGAGTTGG + Intergenic
968645009 4:1736028-1736050 CAGCCCTGTGGCTGGAGGGTAGG - Intronic
969695141 4:8729961-8729983 AAGGCCTGTGTCTGGCTGGGGGG - Intergenic
971711596 4:30119993-30120015 CTGCACTGTGACTGGCTGCTAGG - Intergenic
972678313 4:41281418-41281440 TGGCCCTGTGAATTGCTTGTTGG + Intergenic
975418453 4:74134156-74134178 TAGCACTGTGACTGCCTGGAGGG + Intronic
982069068 4:151679422-151679444 GAGCCCTGGGACTGGCTGGGAGG + Intronic
982345706 4:154355502-154355524 CAGCCCTGAGGGTGGCTGGTTGG - Intronic
985873377 5:2576986-2577008 TTGCCCTGTGACGGTCTGCTGGG - Intergenic
986152290 5:5139560-5139582 GAGGCCGGTGACTGGCTGCTGGG - Intergenic
987481620 5:18466171-18466193 CAGTGCTGTGACTGGCTGGGTGG + Intergenic
990252262 5:53928014-53928036 TAGCTCAGTGCCTGGCAGGTAGG + Intronic
990716602 5:58644421-58644443 TAGCCCCGTGCCTGCATGGTAGG + Intronic
992301855 5:75390813-75390835 TAACCCTGTCTCTGGCGGGTAGG - Intronic
995438767 5:112166511-112166533 TAGCCATGTGAGTGGCTGCAAGG - Intronic
999693035 5:154165446-154165468 TAGCACTGTGTCTGGCTCATGGG + Intronic
1003320914 6:5050259-5050281 TAGCTGTTTGCCTGGCTGGTGGG - Intergenic
1004793120 6:19051036-19051058 TAGCCCTGGGAAGGGCTGGTGGG - Intergenic
1005694022 6:28335108-28335130 TAGCCCTTTCACAGGGTGGTGGG - Intronic
1005713609 6:28525899-28525921 CAGCCCTGTGACTGGCCTGTGGG + Intronic
1007619816 6:43205122-43205144 TAGCCCTGTGGGGAGCTGGTGGG - Intronic
1010365894 6:75050663-75050685 TAGCCCTGTGAGGGGCAGGAGGG - Intergenic
1013033630 6:106360384-106360406 TTGGCCTGTGACAGGCTGGCAGG - Intergenic
1014758483 6:125328199-125328221 TTGCCCAGTAACTGGCTGCTAGG - Intergenic
1015885095 6:137909736-137909758 GAGCCCTGTGAGGGGCAGGTAGG + Intergenic
1017382417 6:153845862-153845884 CAGCCCTGTGACTGATTGATAGG + Intergenic
1019399269 7:842273-842295 TTGCTGCGTGACTGGCTGGTAGG + Intronic
1019927250 7:4201543-4201565 TAGCCCATTGACTGACTGTTTGG - Intronic
1022237328 7:28474467-28474489 TTGCCCTATGACTGGCTGATTGG + Intronic
1023293352 7:38690088-38690110 CAGCCCAGGGACTGGCTGTTGGG - Intergenic
1024903951 7:54354593-54354615 TAGCCGTGTGACTGGCTGGCTGG + Intergenic
1026968750 7:74455256-74455278 TGGCCCTGGGCCTGGCGGGTGGG + Intronic
1027486134 7:78763963-78763985 CAGCCCTGTGTCTGGCTTGAAGG - Intronic
1033425879 7:141243725-141243747 CAGCCCTGTCACTGGCTGCATGG - Intronic
1036702064 8:11019449-11019471 CAGAGCTGTGACTGGCTGGAGGG + Intronic
1036749773 8:11436357-11436379 CAGTCCTGGGACTGGCTGCTTGG - Intronic
1037361891 8:18083400-18083422 TAGCCCTGTGACTTGCTCGTGGG + Intronic
1041660183 8:60393577-60393599 TAGCCCTGTGTCTGGCACATCGG + Intergenic
1047141067 8:122140391-122140413 TAGCACTGTGTGTGGCTGATTGG - Intergenic
1048949512 8:139483753-139483775 GAGCCATGTGACTGCCTGTTGGG - Intergenic
1049095463 8:140545721-140545743 GAGCCCTGGGACTTGCTGGCAGG - Intronic
1050596690 9:7211457-7211479 AATCCCTGGGTCTGGCTGGTAGG - Intergenic
1050620801 9:7450067-7450089 CAGCCCAGTGACTGGCGGGAAGG + Intergenic
1052245205 9:26325908-26325930 TAGCTCTGCTACTTGCTGGTTGG + Intergenic
1052817093 9:33110136-33110158 TGGCCCTGGGTCAGGCTGGTTGG - Intronic
1056827084 9:89883895-89883917 TAGCCCTGGGACTCTCCGGTGGG + Intergenic
1060667285 9:125439463-125439485 AAGCTCTGCGCCTGGCTGGTGGG - Intronic
1061486519 9:130923195-130923217 CTGCCCTGTGACTGGCAGTTGGG + Intronic
1061865951 9:133491857-133491879 CAGCCCTGAGCCTGGCTGGTTGG + Intergenic
1186535226 X:10340364-10340386 TTGCCCTCTGACTGTCTGTTTGG + Intergenic
1187226592 X:17379182-17379204 TTGCCCTGAGACAGGCTGGGGGG + Intronic
1187935796 X:24334646-24334668 CAGCCATGTGACTGGAGGGTTGG - Intergenic
1195470355 X:105222779-105222801 TAGCCCTGTTATTGACTAGTTGG + Intronic
1197834452 X:130679537-130679559 AAGCCCTGTATCTGTCTGGTAGG - Exonic
1198413205 X:136392557-136392579 TAGCACTGTGACAGATTGGTGGG + Intronic