ID: 1073634126

View in Genome Browser
Species Human (GRCh38)
Location 10:105179933-105179955
Sequence CAGGGTTAACAGTAAGGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 173}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073634126_1073634135 28 Left 1073634126 10:105179933-105179955 CCTTCCCCTTACTGTTAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1073634135 10:105179984-105180006 GAGAAAAAACAGCCACTCTAAGG No data
1073634126_1073634133 5 Left 1073634126 10:105179933-105179955 CCTTCCCCTTACTGTTAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1073634133 10:105179961-105179983 CTCTTTAGCTCTGTGTGGTCAGG No data
1073634126_1073634132 0 Left 1073634126 10:105179933-105179955 CCTTCCCCTTACTGTTAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1073634132 10:105179956-105179978 ATTCTCTCTTTAGCTCTGTGTGG No data
1073634126_1073634134 6 Left 1073634126 10:105179933-105179955 CCTTCCCCTTACTGTTAACCCTG 0: 1
1: 0
2: 0
3: 18
4: 173
Right 1073634134 10:105179962-105179984 TCTTTAGCTCTGTGTGGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073634126 Original CRISPR CAGGGTTAACAGTAAGGGGA AGG (reversed) Intronic
901055023 1:6445380-6445402 CAGGGTCACCTGGAAGGGGAGGG - Intronic
902479341 1:16703234-16703256 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
902513088 1:16976640-16976662 CAGGGTTGACAGGGTGGGGAGGG + Intronic
904031029 1:27533500-27533522 CAGGGTAGACAGAAAGGGGAGGG + Intergenic
906200689 1:43958345-43958367 AAGGGATAAGAGGAAGGGGAAGG - Intronic
906733758 1:48104985-48105007 CAGGGAGAAAAGGAAGGGGAGGG + Intergenic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907775267 1:57507864-57507886 CAGATTTAAAAGTATGGGGAGGG - Intronic
909873885 1:80779157-80779179 CCTGGTGAAGAGTAAGGGGATGG - Intergenic
910013372 1:82492445-82492467 AAGAGCTAACAGGAAGGGGAGGG + Intergenic
913248112 1:116888124-116888146 CAGGGATAAGGGGAAGGGGAGGG + Intergenic
915267743 1:154731095-154731117 CAGGGTTGCCAGTAGGTGGATGG - Intronic
917176559 1:172242292-172242314 CAGGGTGAACAGCAAGGGGTGGG - Intronic
917661818 1:177184303-177184325 GAGGGTGAAAAGTAAGGGGAGGG - Intronic
918181151 1:182086779-182086801 CAGGGTTGACAGGAAGGGACAGG + Intergenic
919765646 1:201125616-201125638 CAAGGTGAACAGCAAGGCGAGGG - Intronic
920242145 1:204560875-204560897 CAGGGATAACAGTGAGGCCATGG + Intergenic
920306014 1:205018579-205018601 CAGGGTAAACAGCAGGGGGTGGG + Exonic
924607007 1:245543599-245543621 CATGGGTAACAGTGAGGGGGAGG + Intronic
1063382094 10:5591840-5591862 CAGGGCTAGCAGCAAAGGGAAGG + Intergenic
1063649516 10:7919011-7919033 GAGGTTTAACAGGAAGGTGAAGG + Intronic
1070376366 10:75835167-75835189 CAGGGCTAAAATTAAGGTGATGG + Intronic
1070499150 10:77054029-77054051 CAGGGATAACAGGAAGGGTGAGG + Intronic
1070983073 10:80665834-80665856 CAGGGTTAGTGGGAAGGGGACGG + Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1072247472 10:93556131-93556153 TAAGGTCAACAGTAAGGGGGAGG - Intergenic
1072730687 10:97844261-97844283 CAGGGCAAACAGAGAGGGGATGG - Intergenic
1073054773 10:100692310-100692332 AATGGTTGACAGCAAGGGGAAGG - Intergenic
1073634126 10:105179933-105179955 CAGGGTTAACAGTAAGGGGAAGG - Intronic
1077508386 11:2942727-2942749 CAGGGTGAACAGTCACAGGAAGG + Intergenic
1083429879 11:62608789-62608811 CAGGGTGAACAGCAAGGCTAAGG + Exonic
1084793658 11:71490468-71490490 CAGAGTTGACAGGCAGGGGAGGG + Intronic
1086514384 11:87594965-87594987 CAGGGTGAAGAGTGAGGGGAGGG + Intergenic
1088583517 11:111337092-111337114 CAAGGTTCACTGGAAGGGGAAGG + Intergenic
1091434728 12:463250-463272 CAGGGTTACCAGTAATGACAGGG + Intronic
1092090739 12:5801881-5801903 CAGGGTTTGCACTCAGGGGAGGG - Intronic
1092184279 12:6467249-6467271 CTGGGTTAACAGGGAGAGGATGG + Intronic
1092984149 12:13829032-13829054 AAGGGTTAACAGCAAGGTGAAGG - Intronic
1097347114 12:58505773-58505795 AAAGGTGAACAGTCAGGGGAGGG + Intergenic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097560126 12:61192987-61193009 CGGGGTTTACAGTAAGGACATGG + Intergenic
1097811243 12:64021533-64021555 CAGGGTGCACAGTAAGTGGCAGG + Intronic
1098195623 12:67998509-67998531 CAGGGATAACAGGAAGGAGTTGG + Intergenic
1098395969 12:70017065-70017087 CAGGGCTATCAGTCAGGAGAAGG + Intergenic
1100167632 12:91935523-91935545 CAAGGTTAACAGGAAGAGGTAGG + Intergenic
1101694209 12:107109276-107109298 GAAGGTTAAAGGTAAGGGGAGGG + Intergenic
1103206537 12:119133911-119133933 CAAGGTTAGCAGACAGGGGAGGG + Intronic
1103561353 12:121794703-121794725 CAGGGTGAGGAGTAAGAGGAGGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1106320679 13:28635321-28635343 CAGGGTGAACCCTAATGGGAAGG + Intergenic
1106767091 13:32923874-32923896 CAGAGTTACCAGTAAAGGGCTGG + Intergenic
1108066874 13:46586767-46586789 CAGCTTTAACAGTGAGGGGTAGG + Intronic
1108163967 13:47672633-47672655 CAGAGTTTACAGCAAGGGGAGGG + Intergenic
1114464664 14:22913076-22913098 TAGGGATAGAAGTAAGGGGAAGG + Intronic
1115665591 14:35541721-35541743 CAAGGTAAACAGCAATGGGAGGG - Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117274403 14:54178390-54178412 CATACCTAACAGTAAGGGGAGGG + Intergenic
1119566458 14:75633244-75633266 CAGGGTCATCAGGAAGAGGAGGG + Intronic
1119701671 14:76760320-76760342 AAGGGTTATCAGTGATGGGAAGG - Intergenic
1119856341 14:77904013-77904035 AAGGCTTACCACTAAGGGGAGGG + Intronic
1124036870 15:26061665-26061687 CAAGGTTAGCATCAAGGGGAGGG + Intergenic
1125987327 15:44066824-44066846 CAAGATTAAAAGTAAAGGGAAGG + Intronic
1128373619 15:67059491-67059513 CTGGGCTAGCAGTAAGGGGCTGG + Intergenic
1128603747 15:69018806-69018828 CAGGATTAAAGGTCAGGGGATGG + Intronic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1131583119 15:93664648-93664670 CAGGGTTAGCAGTTAGAGGAGGG - Intergenic
1131891700 15:96979087-96979109 CAGGGATAACAAGAAGGGGGTGG - Intergenic
1131919616 15:97309924-97309946 GAGGGTTAAAAATCAGGGGATGG - Intergenic
1132633141 16:929366-929388 CAGGGTCCACACTCAGGGGATGG + Intronic
1133140111 16:3737410-3737432 AAGGTTTAACAGCAAGGGGCAGG + Intronic
1133832102 16:9332866-9332888 CTGGGTTAACATCAAGGGGTAGG + Intergenic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1137552588 16:49450292-49450314 TAGGGTTAAAAGTAAAAGGATGG - Intergenic
1138745444 16:59357891-59357913 CAGATTTAACAGTAGGGGGAAGG + Intergenic
1141593362 16:85082991-85083013 CAGTGTGAACAGTAAGGCCAAGG - Intronic
1141753658 16:85976778-85976800 CAGGGTGAAGTGTAAAGGGATGG + Intergenic
1142660806 17:1428028-1428050 CTGTGTTAACAGCAAGGGGTGGG - Intronic
1142911412 17:3096361-3096383 CAAGGTTGAAAGTAAGAGGATGG + Intergenic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1144552960 17:16257579-16257601 CAGGGTTGACAGTAATAGGCAGG + Intronic
1146061778 17:29611655-29611677 CAGGGGTACCCGTAAGTGGAGGG + Intronic
1147390977 17:40108978-40109000 CATGGTAAACAGTGGGGGGAGGG + Intergenic
1147760258 17:42793564-42793586 GAGGGTCAACAGGATGGGGAGGG - Intronic
1150427282 17:65086716-65086738 AAGGGAGAACAGGAAGGGGAAGG - Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1153709437 18:7783202-7783224 AAGGGTGATCAGCAAGGGGATGG + Intronic
1153748944 18:8209821-8209843 CAGGGTGAGGGGTAAGGGGAGGG + Intronic
1155500772 18:26484814-26484836 CAGGGTTTGGAGTAAGGGGAAGG + Intronic
1155709481 18:28858501-28858523 CAAGGTTGACAGTAGGGGAAGGG - Intergenic
1155991670 18:32285048-32285070 CCGGGTAAAAAGTAAGGGGGCGG - Intronic
1159892445 18:73965377-73965399 CAGGCTTAACAGAAAATGGATGG + Intergenic
1161025145 19:2033378-2033400 CTGGGGTAGCAGTAAGGGGGAGG + Intronic
1161284106 19:3459961-3459983 CAGGGTGGACTGTGAGGGGAGGG - Intronic
1162884997 19:13690407-13690429 CAGGGTAATCAATAAGGGGATGG + Intergenic
1166060658 19:40323509-40323531 CAGGGCTTCCAGTGAGGGGACGG + Intronic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1168332579 19:55578858-55578880 GAGGGCGAACAGGAAGGGGAAGG - Exonic
1202713380 1_KI270714v1_random:29140-29162 CAGGGTCACCTGGAAGGGGAGGG + Intergenic
928046970 2:27944391-27944413 CAGGGTTAAGAGGAAGGTGGTGG - Intronic
928167756 2:28982901-28982923 CATGATTAACCCTAAGGGGAAGG - Intronic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929836573 2:45406522-45406544 CAGGGTTTTCAGCAAGAGGATGG - Intronic
930822019 2:55655835-55655857 CAAGGTTAACAGAGAGAGGAAGG - Intronic
931976053 2:67645570-67645592 CAAGGTTATCAGCAAGGGAATGG + Intergenic
935746894 2:106196489-106196511 GGGGGTTGACAGTAAGGGGAGGG - Intergenic
943425010 2:187720485-187720507 CAGGGTTAAGAGTGACAGGAGGG - Intergenic
944632695 2:201643189-201643211 CAGTGTTCACAGGAATGGGACGG - Intronic
945034585 2:205693685-205693707 CTGGGTTACCAGGAAAGGGAGGG - Intronic
946417299 2:219546519-219546541 CTGGGATCACAGTATGGGGAGGG - Intronic
946507501 2:220317480-220317502 CAGGGTTAACAGTAGATGGTCGG - Intergenic
946596363 2:221309948-221309970 AGGGGATACCAGTAAGGGGAAGG - Intergenic
947074665 2:226329478-226329500 CAGGGGTGACAGTGAGTGGATGG - Intergenic
947491289 2:230596583-230596605 ATGGGTTAAAAGTAAAGGGATGG + Intergenic
947711038 2:232315967-232315989 CCGGGTTACCAGTAGGGGGTAGG + Intronic
947865931 2:233397732-233397754 GAGGGTGAACTGGAAGGGGAGGG + Intronic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
948674789 2:239590499-239590521 CTGGGTTATCAGAAAGGTGAAGG + Intergenic
949056849 2:241932489-241932511 CAAGGTTTCCAGGAAGGGGAAGG - Intergenic
1172927492 20:38552057-38552079 CACTGTTAACAGTAAAGGCAAGG + Intronic
1174044938 20:47726849-47726871 CAGGGTCAAAAGTGAGGGAAGGG - Intronic
1175362476 20:58424254-58424276 CAGGGTTAACAGTAAGTCTAAGG - Intronic
1177436157 21:21055672-21055694 CAAGGTTAGCAGTTAGGAGAAGG + Intronic
1179961980 21:44772749-44772771 CAGGGCTAAGAGGAAGGGGTGGG - Intronic
1183290684 22:36999998-37000020 CAGGGATGACAGACAGGGGATGG + Intronic
1183334484 22:37238880-37238902 AGGGGTTAACAGCAAAGGGATGG - Intronic
1183811246 22:40259593-40259615 CAGGCCTCCCAGTAAGGGGAGGG - Intronic
1184095290 22:42313050-42313072 CAGGGTCCACAGTATGGTGATGG - Intronic
951477954 3:23128753-23128775 CAGAGTGAAGAGAAAGGGGAAGG - Intergenic
951726328 3:25764901-25764923 GATGGTTAACAGTAATAGGAAGG + Intronic
954582362 3:51709859-51709881 CAGGGTTAACATCAAGGGTGAGG - Intronic
955075184 3:55607009-55607031 CAGTATTAACAGCAAGGGCAGGG + Intronic
955144227 3:56300114-56300136 CAGGTTTGACAGCAACGGGAGGG + Intronic
957038350 3:75315768-75315790 GAAGGTGATCAGTAAGGGGAGGG + Intergenic
959675526 3:109031096-109031118 CAGGGACAACAGTAAGTTGAAGG + Intronic
960611326 3:119557568-119557590 CAGGGTTAAGAGAAAGGACATGG - Intronic
962613121 3:137097757-137097779 CTGGGAAAACAGTCAGGGGAAGG + Intergenic
962886204 3:139630300-139630322 CAGTGAGAACAGTAAGGGAAAGG + Intronic
964427634 3:156569837-156569859 TATGGTTAACAGTAGGGGCATGG - Intergenic
965005282 3:163014089-163014111 AAGGGTTAAGAGAAAGGGGAAGG + Intergenic
965143779 3:164871258-164871280 TAGGGTTAACATCAAGGTGATGG + Intergenic
965517883 3:169641393-169641415 CAGGCTTATCAGTAAGGAGTTGG - Intronic
966935941 3:184709495-184709517 CACGGATAACATGAAGGGGAGGG + Intergenic
966983083 3:185155275-185155297 CTGGGGTAAAAGTCAGGGGAAGG - Intergenic
968762399 4:2449479-2449501 CAGCGTTGGCAGTAAAGGGAAGG - Intronic
969173001 4:5379018-5379040 CAGGGTCAACACTAAGGTCAGGG + Intronic
970671110 4:18397772-18397794 CAGGGTTAATGGTTGGGGGAGGG - Intergenic
972305167 4:37823861-37823883 CAGGTTTTGCAGTCAGGGGAAGG + Intergenic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
979435623 4:120685968-120685990 CAAGGAGAACACTAAGGGGATGG - Intronic
980406592 4:132360967-132360989 CAAGGGTAGCACTAAGGGGATGG - Intergenic
981026011 4:140077716-140077738 CAGGGTTAAAAATAAAGAGAGGG + Intronic
984991245 4:185383644-185383666 CAGTCTTACCAGTTAGGGGATGG - Intronic
985889691 5:2705821-2705843 CTGGGATAAGAGTGAGGGGATGG + Intergenic
997061619 5:130511585-130511607 CAGAGTGAACAGTCAGTGGAAGG + Intergenic
997232051 5:132252601-132252623 CAGGGTTGACAAGAAGGAGACGG - Intronic
1001207797 5:169780200-169780222 CAGAGTTTACAGCTAGGGGAAGG - Intronic
1002254782 5:177951026-177951048 AAAGGTAAACAATAAGGGGATGG - Intergenic
1002674504 5:180899861-180899883 CTGTGTTAACAGTAACTGGAAGG - Intronic
1004804994 6:19193796-19193818 CTTGGTTAACAGTATGGGGCTGG + Intergenic
1005126850 6:22456574-22456596 AAGGGTTAAAAGTAAAAGGATGG + Intergenic
1005440251 6:25859868-25859890 CAGGGTAAAAAGTAAGGGGGAGG - Intronic
1005851137 6:29823389-29823411 CAGGGTTAACACCTAGGTGATGG + Intergenic
1006748096 6:36359143-36359165 CAGATTAAACAGAAAGGGGATGG + Intronic
1013207290 6:107956950-107956972 TAGTGTTAACAGTAAGGAGTGGG - Intronic
1016489964 6:144588739-144588761 CACAGTTAAGAGTAAGAGGAAGG - Intronic
1020787612 7:12590628-12590650 CTGGGATAACAGGAAGGAGAGGG + Intronic
1021463656 7:20916942-20916964 CAGGGTTACCAGTGAGGAAATGG - Intergenic
1023278639 7:38547150-38547172 CAGGCCTAAAAGCAAGGGGAGGG - Intronic
1027766940 7:82355953-82355975 GAGGGTTTATAGTATGGGGAGGG - Intronic
1029791716 7:102849881-102849903 CAGGGTTGAGGGTGAGGGGAGGG + Intronic
1030774907 7:113522605-113522627 CAGGCTTAAAAGAAAGGGGAAGG + Intergenic
1031693728 7:124822167-124822189 CAGTGTTTACAGAAAGGGGCAGG + Intergenic
1034493833 7:151408815-151408837 CAGGGTTTACAGCAATGAGAGGG + Intronic
1034572249 7:151965580-151965602 CAGCGTTAACAGTAGGAGGCTGG + Intronic
1037168478 8:15860154-15860176 AAATGGTAACAGTAAGGGGACGG + Intergenic
1037512499 8:19598046-19598068 GAGGGTCAAGAGGAAGGGGAAGG + Intronic
1042801931 8:72728367-72728389 CAGGATTAACAGGAATAGGATGG - Intronic
1045259190 8:100557485-100557507 CAGTGTTGACTGTAAGGGCAAGG - Intronic
1047601083 8:126426528-126426550 CAGGGGGTACAGTAAGGGGAGGG + Intergenic
1051265409 9:15304790-15304812 CAAGGTCAACAGTCATGGGAAGG + Intronic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1052905415 9:33829290-33829312 CAACTTTAACATTAAGGGGAGGG + Intronic
1053064905 9:35061253-35061275 CAGGGATAGCAGTCAGGGGAAGG - Intronic
1056280640 9:85038303-85038325 CAGAGTTTTCAGTAGGGGGATGG - Intergenic
1060904078 9:127288893-127288915 AAGGGTAACAAGTAAGGGGAGGG + Intronic
1187855106 X:23629188-23629210 TAGGCTTAAAAGTATGGGGACGG + Intergenic
1193097041 X:77562028-77562050 CAGGGTTTAGGGTTAGGGGAAGG - Intronic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic
1198931439 X:141865669-141865691 CAGGGCTAACAGCACAGGGAGGG - Intronic
1199974417 X:152884534-152884556 CACGGGTAACAGTTGGGGGAAGG - Intergenic
1202086241 Y:21139801-21139823 CAGCTTTAACAGTAAGAGGACGG + Intergenic