ID: 1073637500

View in Genome Browser
Species Human (GRCh38)
Location 10:105214698-105214720
Sequence GACCCCTGCACCAAAGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 117}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073637495_1073637500 17 Left 1073637495 10:105214658-105214680 CCATTCCCAGAAGGGAAGAAGAA 0: 1
1: 0
2: 4
3: 52
4: 515
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117
1073637491_1073637500 26 Left 1073637491 10:105214649-105214671 CCAACCAGACCATTCCCAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117
1073637496_1073637500 12 Left 1073637496 10:105214663-105214685 CCCAGAAGGGAAGAAGAAGATCT 0: 1
1: 0
2: 1
3: 21
4: 356
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117
1073637490_1073637500 27 Left 1073637490 10:105214648-105214670 CCCAACCAGACCATTCCCAGAAG 0: 1
1: 0
2: 2
3: 11
4: 210
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117
1073637494_1073637500 22 Left 1073637494 10:105214653-105214675 CCAGACCATTCCCAGAAGGGAAG 0: 1
1: 0
2: 2
3: 14
4: 151
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117
1073637497_1073637500 11 Left 1073637497 10:105214664-105214686 CCAGAAGGGAAGAAGAAGATCTT 0: 1
1: 0
2: 1
3: 42
4: 362
Right 1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG 0: 1
1: 0
2: 0
3: 3
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073637500 Original CRISPR GACCCCTGCACCAAAGTCAA TGG Intronic
900688777 1:3966714-3966736 GACATCAGCACCAAAGACAAGGG - Intergenic
900958264 1:5901945-5901967 GCCCCCTCCCCCAAAGACAAAGG + Intronic
904013000 1:27400556-27400578 AAGGCCTGCAGCAAAGTCAAGGG - Intergenic
915448757 1:155990126-155990148 GACCACTTCCCCAAAGTCAGAGG - Intronic
920079454 1:203361805-203361827 GACGGCTGTACCAAACTCAATGG - Intergenic
921941271 1:220842368-220842390 GACCCCTGCACAAAAGCAAATGG - Intergenic
922095230 1:222437923-222437945 AACCCCTGAACCATAGTGAAAGG + Intergenic
1065474580 10:26120209-26120231 GATCCCAGGACCAAAATCAAAGG - Intronic
1066661139 10:37739072-37739094 GTCGCCTGCATCAATGTCAAGGG + Intergenic
1070112482 10:73498632-73498654 GAGTCCTGCAGCACAGTCAATGG - Exonic
1071451076 10:85791881-85791903 GCCCCCTGCACAAAAGCCCAGGG - Intronic
1072551553 10:96481527-96481549 GACACCTGGCCCAAAGGCAATGG - Intronic
1073426718 10:103459487-103459509 GACCCCTGCAGCACACTCACAGG - Intergenic
1073637500 10:105214698-105214720 GACCCCTGCACCAAAGTCAATGG + Intronic
1076502923 10:130951033-130951055 GAACCCTGCACCACTGTCCAGGG - Intergenic
1076566334 10:131402007-131402029 GACCCCTGCACCACCCTCCATGG - Intergenic
1077541169 11:3147190-3147212 GACTCCTGCTCCAGAGTCAGGGG + Intronic
1079754471 11:24239327-24239349 GAGACATGCACAAAAGTCAATGG + Intergenic
1081728215 11:45348041-45348063 GACCCCTGGATAAAAGTCACTGG - Intergenic
1085049311 11:73371962-73371984 GACCCCTGTCCCAAACCCAAGGG - Intergenic
1085303137 11:75470118-75470140 GACACCTGCAGCAAAGTGGAAGG + Intronic
1085398417 11:76219555-76219577 GACCCCTGCACCAGGGTTATGGG - Intergenic
1089762445 11:120738249-120738271 TTCCCTTGCACCAAAGTCCATGG - Intronic
1092255614 12:6925448-6925470 GAGCCCTGGAACAAAGTCAGGGG + Intronic
1092735348 12:11577217-11577239 AACAACTGCACCAAAGACAAAGG - Intergenic
1093549547 12:20391439-20391461 GACCCTTGATCCAGAGTCAACGG - Intronic
1093599991 12:21010424-21010446 GACCCCCCCAACAAATTCAAAGG - Intergenic
1095588828 12:43880596-43880618 GACCCCTGCACCCAGTTCCAAGG - Intronic
1096527036 12:52216246-52216268 GACCCCTGCTCAAGAGTCAGAGG - Intergenic
1096693439 12:53334836-53334858 GTCCCCAGCACCAGAGGCAAGGG + Intronic
1096720301 12:53516383-53516405 CACCACTACACTAAAGTCAAGGG + Exonic
1101846992 12:108370652-108370674 GAGCCCTTCACCACAGTCCACGG + Intergenic
1103568692 12:121830239-121830261 GGCCCCGGCACCAGACTCAAAGG + Exonic
1106088487 13:26563962-26563984 GACCACTGCTCCAAGGTCAGAGG - Intronic
1109359366 13:61275880-61275902 GACTCTTGGACCAAAGACAAAGG + Intergenic
1111659399 13:91190666-91190688 GACTCCTAGACCAAAGACAAAGG + Intergenic
1117090864 14:52248581-52248603 GCCACCTGCACCACAGACAAGGG + Intergenic
1117878753 14:60284847-60284869 GAACACTGAACCCAAGTCAAGGG - Intronic
1118235487 14:64000342-64000364 GACCCATTCAGTAAAGTCAAGGG - Intronic
1118973475 14:70656916-70656938 GTCTACTACACCAAAGTCAAGGG + Intronic
1121610229 14:95273627-95273649 GGCCCCTGCAGCAATGTCCAGGG + Intronic
1122698997 14:103574418-103574440 GACCTCAGTACGAAAGTCAAAGG - Intronic
1124063682 15:26319728-26319750 GACCCCAGCACCAGAATCACTGG - Intergenic
1124105805 15:26736882-26736904 GACTTTTGCATCAAAGTCAAAGG - Intronic
1124666477 15:31597544-31597566 GAGGCCTGCACCAAGGGCAAGGG - Intronic
1127646110 15:60961065-60961087 GACCACTCCATCAAGGTCAAGGG + Intronic
1131958551 15:97764020-97764042 GACCCCTGCAGAAAGGTCACTGG - Intergenic
1132525501 16:412161-412183 GTCCCCTGCCCCATGGTCAAGGG + Exonic
1133719770 16:8484051-8484073 GAGCCCTGCTACAAAGTCCAGGG - Intergenic
1134675849 16:16090124-16090146 GACCCCTGCCCCAGATTCCAGGG - Intronic
1134843870 16:17423562-17423584 GACTCCTGCACAAAAGCCCAGGG - Intronic
1140985250 16:80152547-80152569 GACCTTCACACCAAAGTCAAGGG + Intergenic
1142088332 16:88196554-88196576 CACCACTCCACCAAACTCAATGG - Intergenic
1161102111 19:2426379-2426401 CACCCCTGCCCCAAAGGCTAAGG - Exonic
1168509464 19:56962594-56962616 GACCACAGCACCAACGCCAAGGG - Intergenic
926231273 2:11005854-11005876 GACCCCTGCACCAGACTAGAAGG - Intergenic
926279563 2:11434579-11434601 GACCCCAGCATCACGGTCAATGG - Intergenic
926409476 2:12587940-12587962 GACTCCTGGACCAGAGACAAAGG - Intergenic
929225513 2:39508079-39508101 GACTCCTGGGCCAAAGGCAAAGG - Intergenic
930843765 2:55878979-55879001 GACACCTGAACCAAAGTAAGGGG - Intronic
938106513 2:128534786-128534808 AACCCCTGCACCCAAGCCCAAGG + Intergenic
938636384 2:133231401-133231423 GGCCCATTCACAAAAGTCAAAGG + Intronic
938657775 2:133452239-133452261 CATCCCTGCTCCAAAGACAAGGG + Intronic
940971222 2:159899032-159899054 GACCCCTTCACCATCGTCCATGG - Exonic
941008019 2:160267294-160267316 GACCCATTCATAAAAGTCAAGGG - Intronic
945466087 2:210171558-210171580 AAACCCTGCACCAGAGTTAAGGG - Intergenic
948666247 2:239536427-239536449 AACACCTGCACCAGAGTCCAGGG - Intergenic
1170800648 20:19587357-19587379 AACACCTGCATCAAAGGCAAAGG + Intronic
1172170442 20:32927780-32927802 AATCCCTGAACCAAAGACAAAGG - Intronic
1173187045 20:40848291-40848313 TACCCCTGCCGCAAAGTCAGCGG + Intergenic
1175410055 20:58761877-58761899 TAACCCTGCACCAAAGGGAAGGG - Intergenic
1175410170 20:58762549-58762571 TAACCCTGCACCAAAGGGAAGGG - Intergenic
1178408869 21:32347668-32347690 GACCCCTGCACTAAAGTGGGTGG + Exonic
1179344722 21:40546095-40546117 GACCCCTGCATGAAACTCAGCGG + Intronic
1184186719 22:42869644-42869666 GACCCCTGCCCAAAAGGCCACGG - Intronic
1184428195 22:44425376-44425398 GACCCCCGCAACAAACACAAGGG - Intergenic
953882119 3:46696020-46696042 GTCCCCTGCAGCACAGCCAAGGG + Intergenic
954122002 3:48504858-48504880 GACCCCTGCCCCGAAGTGAGGGG - Intergenic
954430529 3:50468517-50468539 GGGCCCTGCAGCAAAGCCAAGGG + Intronic
955614325 3:60790215-60790237 TAGCAATGCACCAAAGTCAACGG + Intronic
957244788 3:77702991-77703013 GACCCCTGCACCCAGCTCACCGG + Intergenic
959112315 3:102136139-102136161 GACCCCAGCACCAAAACCACTGG + Intronic
959524545 3:107361807-107361829 GACTCCTGCATCAGAGACAAAGG - Intergenic
963774276 3:149422569-149422591 TACTCCGTCACCAAAGTCAATGG - Intergenic
964057970 3:152484750-152484772 GACCCCTGCACCAAGATCTCTGG + Intergenic
968577305 4:1373889-1373911 GATGCCTCCACCAAAGACAAAGG - Intronic
969497910 4:7536553-7536575 GACCTCTGCCCCACAGTCATGGG - Intronic
970464060 4:16305537-16305559 GATGCCTGCCCCAAAGCCAAAGG + Intergenic
972320102 4:37965500-37965522 TACCCCTGCTCCAAGATCAAGGG - Intronic
974120512 4:57632414-57632436 GACCCTTGCATGAAAGTCAGAGG + Intergenic
975410320 4:74041033-74041055 AACCTCTGCACCAGAGACAAGGG + Intergenic
987400431 5:17469955-17469977 AACCCCTGCAACACAGTGAAGGG + Intergenic
995192171 5:109329538-109329560 GACCCCTGGATCAGAGACAAAGG - Intergenic
997728920 5:136149947-136149969 TACCCATTCACCAAAGTCACTGG + Intronic
998518810 5:142781575-142781597 GACACCTGCACCCAAGCCTAAGG - Intronic
998907560 5:146922762-146922784 GATCACTGCAGCAAAGCCAATGG - Intronic
1004375872 6:15090213-15090235 GACCCAGGAAACAAAGTCAACGG - Intergenic
1006648637 6:35533110-35533132 GATACCTTCATCAAAGTCAAAGG - Intergenic
1007230320 6:40343659-40343681 GAGCCCTGCACCCAAGAGAAAGG - Intergenic
1011897765 6:92253291-92253313 CACCCCTGAAACAAAGTCCAAGG + Intergenic
1014478356 6:121903327-121903349 GACCCCTGAGTCAAAGTCAAAGG - Intergenic
1016778996 6:147937544-147937566 AACCCCTGCTCCCAAGTCTAAGG - Intergenic
1020467388 7:8496238-8496260 GACCCCTTCACCAATCTCAGAGG + Intronic
1022562312 7:31362550-31362572 GACTCCTGCACCCAATTCAGTGG - Intergenic
1024762198 7:52612206-52612228 CTCCCCTGCACCAAAATCCATGG + Intergenic
1024957121 7:54933874-54933896 GACTCGTCCTCCAAAGTCAATGG - Intergenic
1027721581 7:81748358-81748380 GACACCTTATCCAAAGTCAATGG + Intronic
1030093982 7:105881498-105881520 GCCTCCTGCACCATAGTAAATGG - Intronic
1032096290 7:128939834-128939856 GAGCCCTAGACCTAAGTCAATGG - Intronic
1035157814 7:156928531-156928553 GACCCCTGGCCCTAAGTCAAAGG + Intergenic
1037359121 8:18054365-18054387 GACTCCTGGGCCAAAGGCAAAGG + Intergenic
1040298663 8:46176526-46176548 GCACCCTGCTCCAAAGTCTAGGG - Intergenic
1050620821 9:7450237-7450259 GACCCCTGAACAAAGGACAAAGG + Intergenic
1061899623 9:133666256-133666278 CACCCCTGCACCCCAGGCAAAGG + Intronic
1062055643 9:134468543-134468565 GACCTCTGCACCCACCTCAAAGG + Intergenic
1062718260 9:138022092-138022114 GACCCCTACTCCAATGTCATGGG - Intronic
1190119590 X:47649575-47649597 GACTCCTGCACCACAGTGAGAGG + Intronic
1193039221 X:76987270-76987292 AACCCCTTCCCCACAGTCAAGGG + Intergenic
1193901414 X:87182742-87182764 AACCCCTGCAAAAAAGTCTAAGG - Intergenic
1194746369 X:97632857-97632879 GACCACTTCCCCCAAGTCAAAGG - Intergenic
1198626524 X:138582001-138582023 GAACCCTGTACAAAAGTGAAAGG - Intergenic