ID: 1073640335

View in Genome Browser
Species Human (GRCh38)
Location 10:105246067-105246089
Sequence TGATCTCTATTCACAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073640332_1073640335 13 Left 1073640332 10:105246031-105246053 CCCTGCCTTGTAGGACTCATTGC 0: 1
1: 0
2: 5
3: 7
4: 93
Right 1073640335 10:105246067-105246089 TGATCTCTATTCACAACAGATGG No data
1073640334_1073640335 8 Left 1073640334 10:105246036-105246058 CCTTGTAGGACTCATTGCTCAGT 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1073640335 10:105246067-105246089 TGATCTCTATTCACAACAGATGG No data
1073640333_1073640335 12 Left 1073640333 10:105246032-105246054 CCTGCCTTGTAGGACTCATTGCT 0: 1
1: 0
2: 0
3: 17
4: 109
Right 1073640335 10:105246067-105246089 TGATCTCTATTCACAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073640335 Original CRISPR TGATCTCTATTCACAACAGA TGG Intronic
No off target data available for this crispr