ID: 1073641220

View in Genome Browser
Species Human (GRCh38)
Location 10:105254575-105254597
Sequence TCTTACATGCAGGTTCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073641220_1073641225 -2 Left 1073641220 10:105254575-105254597 CCCTGCAGAACCTGCATGTAAGA No data
Right 1073641225 10:105254596-105254618 GAAGTTGGGCCTCTGCAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073641220 Original CRISPR TCTTACATGCAGGTTCTGCA GGG (reversed) Intronic
No off target data available for this crispr