ID: 1073643547

View in Genome Browser
Species Human (GRCh38)
Location 10:105276775-105276797
Sequence CTTTATTTATGTTCATCTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073643544_1073643547 20 Left 1073643544 10:105276732-105276754 CCCTACTGTTGCTTCATAGGAAA No data
Right 1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG No data
1073643545_1073643547 19 Left 1073643545 10:105276733-105276755 CCTACTGTTGCTTCATAGGAAAT No data
Right 1073643547 10:105276775-105276797 CTTTATTTATGTTCATCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073643547 Original CRISPR CTTTATTTATGTTCATCTAA TGG Intergenic
No off target data available for this crispr