ID: 1073646715

View in Genome Browser
Species Human (GRCh38)
Location 10:105312269-105312291
Sequence TTCCATGTGCCCTCACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073646715_1073646718 -2 Left 1073646715 10:105312269-105312291 CCACCATGTGAGGGCACATGGAA No data
Right 1073646718 10:105312290-105312312 AAGGCACTATCTGTGAGTAACGG No data
1073646715_1073646719 -1 Left 1073646715 10:105312269-105312291 CCACCATGTGAGGGCACATGGAA No data
Right 1073646719 10:105312291-105312313 AGGCACTATCTGTGAGTAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073646715 Original CRISPR TTCCATGTGCCCTCACATGG TGG (reversed) Intergenic
No off target data available for this crispr