ID: 1073656680

View in Genome Browser
Species Human (GRCh38)
Location 10:105424459-105424481
Sequence CTCTTCTGAGATACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073656680_1073656681 3 Left 1073656680 10:105424459-105424481 CCAAGAGCTGTATCTCAGAAGAG No data
Right 1073656681 10:105424485-105424507 AGTTATCTGCAGAAGATGTCAGG No data
1073656680_1073656683 26 Left 1073656680 10:105424459-105424481 CCAAGAGCTGTATCTCAGAAGAG No data
Right 1073656683 10:105424508-105424530 GCCTTGCTCAAAAATCCTAAAGG No data
1073656680_1073656682 4 Left 1073656680 10:105424459-105424481 CCAAGAGCTGTATCTCAGAAGAG No data
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073656680 Original CRISPR CTCTTCTGAGATACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr