ID: 1073656682

View in Genome Browser
Species Human (GRCh38)
Location 10:105424486-105424508
Sequence GTTATCTGCAGAAGATGTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073656679_1073656682 15 Left 1073656679 10:105424448-105424470 CCAGTAACAGGCCAAGAGCTGTA No data
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data
1073656678_1073656682 16 Left 1073656678 10:105424447-105424469 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data
1073656676_1073656682 25 Left 1073656676 10:105424438-105424460 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data
1073656680_1073656682 4 Left 1073656680 10:105424459-105424481 CCAAGAGCTGTATCTCAGAAGAG No data
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data
1073656677_1073656682 22 Left 1073656677 10:105424441-105424463 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1073656682 10:105424486-105424508 GTTATCTGCAGAAGATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073656682 Original CRISPR GTTATCTGCAGAAGATGTCA GGG Intergenic
No off target data available for this crispr