ID: 1073667473

View in Genome Browser
Species Human (GRCh38)
Location 10:105550045-105550067
Sequence CCATAACAGCACAAAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073667470_1073667473 22 Left 1073667470 10:105550000-105550022 CCAGAAGGCAGCAGATTAACAAA No data
Right 1073667473 10:105550045-105550067 CCATAACAGCACAAAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073667473 Original CRISPR CCATAACAGCACAAAGAAGG TGG Intergenic
No off target data available for this crispr