ID: 1073670223

View in Genome Browser
Species Human (GRCh38)
Location 10:105579705-105579727
Sequence CAGTACAACCAGCTGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073670223_1073670227 17 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670227 10:105579745-105579767 ACTGAGCCTGGGGCTTTTATAGG No data
1073670223_1073670230 27 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670230 10:105579755-105579777 GGGCTTTTATAGGCCTCAGAGGG No data
1073670223_1073670226 7 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670226 10:105579735-105579757 CTCAGCTTTGACTGAGCCTGGGG No data
1073670223_1073670225 6 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670225 10:105579734-105579756 GCTCAGCTTTGACTGAGCCTGGG No data
1073670223_1073670224 5 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670224 10:105579733-105579755 AGCTCAGCTTTGACTGAGCCTGG No data
1073670223_1073670229 26 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670229 10:105579754-105579776 GGGGCTTTTATAGGCCTCAGAGG No data
1073670223_1073670231 28 Left 1073670223 10:105579705-105579727 CCTCTCTGCAGCTGGTTGTACTG No data
Right 1073670231 10:105579756-105579778 GGCTTTTATAGGCCTCAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073670223 Original CRISPR CAGTACAACCAGCTGCAGAG AGG (reversed) Intergenic
No off target data available for this crispr