ID: 1073670518

View in Genome Browser
Species Human (GRCh38)
Location 10:105582553-105582575
Sequence CAAGATTCTGATAATGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073670516_1073670518 -2 Left 1073670516 10:105582532-105582554 CCCTTTGTTTAGACAATGTTTCA No data
Right 1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG No data
1073670517_1073670518 -3 Left 1073670517 10:105582533-105582555 CCTTTGTTTAGACAATGTTTCAA No data
Right 1073670518 10:105582553-105582575 CAAGATTCTGATAATGATATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073670518 Original CRISPR CAAGATTCTGATAATGATAT TGG Intergenic
No off target data available for this crispr