ID: 1073670699

View in Genome Browser
Species Human (GRCh38)
Location 10:105584439-105584461
Sequence CCAATCTTGAAGTAGAGCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073670699_1073670702 -9 Left 1073670699 10:105584439-105584461 CCTTGGCTCTACTTCAAGATTGG No data
Right 1073670702 10:105584453-105584475 CAAGATTGGAGAATGAATGCGGG No data
1073670699_1073670705 8 Left 1073670699 10:105584439-105584461 CCTTGGCTCTACTTCAAGATTGG No data
Right 1073670705 10:105584470-105584492 TGCGGGGAAATTGGAGATGAAGG No data
1073670699_1073670703 -8 Left 1073670699 10:105584439-105584461 CCTTGGCTCTACTTCAAGATTGG No data
Right 1073670703 10:105584454-105584476 AAGATTGGAGAATGAATGCGGGG No data
1073670699_1073670704 -1 Left 1073670699 10:105584439-105584461 CCTTGGCTCTACTTCAAGATTGG No data
Right 1073670704 10:105584461-105584483 GAGAATGAATGCGGGGAAATTGG No data
1073670699_1073670701 -10 Left 1073670699 10:105584439-105584461 CCTTGGCTCTACTTCAAGATTGG No data
Right 1073670701 10:105584452-105584474 TCAAGATTGGAGAATGAATGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073670699 Original CRISPR CCAATCTTGAAGTAGAGCCA AGG (reversed) Intergenic
No off target data available for this crispr