ID: 1073676047

View in Genome Browser
Species Human (GRCh38)
Location 10:105648182-105648204
Sequence CTGCATTTTTTGAGGAAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1073676047_1073676052 -2 Left 1073676047 10:105648182-105648204 CCTTTCTTCCTCAAAAAATGCAG No data
Right 1073676052 10:105648203-105648225 AGTGAGCTGGCCGGGTGCAGTGG No data
1073676047_1073676054 25 Left 1073676047 10:105648182-105648204 CCTTTCTTCCTCAAAAAATGCAG No data
Right 1073676054 10:105648230-105648252 CGCCTGTAATCCCTGCCCTTTGG 0: 9
1: 1659
2: 128958
3: 278713
4: 256191
1073676047_1073676055 26 Left 1073676047 10:105648182-105648204 CCTTTCTTCCTCAAAAAATGCAG No data
Right 1073676055 10:105648231-105648253 GCCTGTAATCCCTGCCCTTTGGG 0: 17
1: 3177
2: 226292
3: 279722
4: 233503
1073676047_1073676051 -10 Left 1073676047 10:105648182-105648204 CCTTTCTTCCTCAAAAAATGCAG No data
Right 1073676051 10:105648195-105648217 AAAAATGCAGTGAGCTGGCCGGG No data
1073676047_1073676057 29 Left 1073676047 10:105648182-105648204 CCTTTCTTCCTCAAAAAATGCAG No data
Right 1073676057 10:105648234-105648256 TGTAATCCCTGCCCTTTGGGAGG 0: 24
1: 4302
2: 301105
3: 274302
4: 212848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1073676047 Original CRISPR CTGCATTTTTTGAGGAAGAA AGG (reversed) Intergenic
No off target data available for this crispr